Biology 52 Summer 2002 - Albert Harris

Review Questions to help studying for the first test, from Summer 2001:

What is meant by a complementary template, in a biological sense? What are some examples? Most enzymes belong to which class of molecules? Molecules of this class consist of which kind of molecular subunit? Could you draw the atomic structure of one of these subunits? What are the structures of 4 specific amino acids? Which part of their molecular structure is the same in all 20 of the amino acids from which proteins are made? Which part differs from one amino acid to another? Which part is the same for all of them? How does glycine differ from alanine? How does cysteine differ from serine? How are they similar? To what part of serine are phosphates attached by kinase enzymes, and for what purpose? As you will learn later, threonine and tyrosine are the two other amino acids to which kinases sometimes attach phosphates: in what respect would you guess that their atomic structure resembles serine? Would you expect the earliest life forms to have been made both of proteins and nucleic acids? Or might they have had only one or the other? Which one? Why? Why not just the other? What was the key discovery that revealed the possibility that they only had one or the other? How are bacterial cells different from human cells? To which of these are plant cells closest? What about the cells of amoebae and other protozoa? What about blue-green algae? Can you list 4 or 5 fundamental differences in structure and chemistry? Which use DNA as their genetic material? What are the only forms of life living today that use RNA instead of DNA as their genetic material? How is ATP related to RNA synthesis? How can energy stored in (or carried by) ATP used to drive chemical reactions that would otherwise not be spontaneous? Specifically, how would ATP provide energy to drive the polymerzation of glucose sugar into a chain (polysaccharide, such as starch or cellulose)? How would glucose phosphate be involved in this process? Where would the phosphate be donated from? When would this phosphate be detached from the glucose, and what would be accomplished by this detachment. In what sense are RNA and DNA structurally like polysaccharides? What are the two key differences, structurally? If cells synthesized long chains of alternating phosphates and ribose sugars, then in order to cause the polymerization reaction to occur spontaneously, why would the precursors need to consist at least of ribose di-phosphates, and perhaps even of ribose tri-phosphates? (i.e. not just ribose-mono-phosphates, equivalent to the glucose monophosphates used in synthesis of cellulose, etc.?) Where might you get the energy, as well as the phosphates, needed to synthesize ribose tri-phosphates? How is the structure of ribose triphosphate similar to the structure of ATP? Imagine that you wanted to synthesize chains of alternating phosphates and ribose sugars, with adenines also attached to each ribose...What would make good precursors? Why might this synthesis be energetically favorable? Would you expect that guanosine tri-phosphate (GTP) could also be used as a source of energy to drive biochemical reactions? (but for some reason CTP, UTP and TTP are NOT used much for this kind of purpose, except of course in the synthesis of what? Guess why there are enzymes that catalyse ATP + CDP -> ADP + CTP.

Where is DNA located in procaryotic cells? What about in eucaryotic cells (3 places!)? What are a few examples of differentiated cells in the body of an animal or a plant? Their differences do NOT result from having different DNA base sequences = genes: instead, what DOES cause their differences? Please make an educated guess how a mutation in a differentiated cell's gene for a kinase might be able to cause cancer! Antibiotics such as streptomycin are poisons that harm procaryotes more than they harm eucaryotes: but researchers were surprised and disappointed that many antibiotics (including streptomycin) also harm mitochondria and/or chloroplasts; explain the likely reason, in evolutionary terms. From what origin is it believed that mitochondria and chloroplasts evolved? Would you guess that plant cells might be able to survive and reproduce if they lost all their mitochondria? What if they lost all their chloroplasts? What about if they lost their nucleus? Would they be able to regenerate them?

Explain why the addition of citric acid, and certain other related compounds to mixtures of the enzymes responsible for the Krebs (=citric acid) cycle, seemed to behave like enzymes themselves insofar as increasing the rate of oxidation of acetate (2 carbon fatty acid). Radioactive carbon-14 was not available then, but can you figure out how it could have been used to prove that the citric acid, succinic acid etc. were not really acting like enzymes? hint: Where would you find the radioactivity soon after putting labeled citric acid into the mixture of enzymes? How would this differ from what should have happened if the citric acid were somehow acting as an enzyme or as a coenzyme? If you had added C-14 labeled acetate, then why would the expected results not have been expected to be much different, in the long term? (Except that in the short term you could find some radioactively labeled citric acid, alpha-keto-glutaric acid etc.!). Guess whether it would be possible in principle to "fix" CO2 out of the air by running chemical reactions of the Krebs cycle backwards.

If you covalently bonded an amino group (-NH2) to the methyl-group carbon of acetic acid, then what would the resulting chemical be? How could you make pyruvic acid (in principle, anyway) by knocking off the amino group from alanine, if a double bonded oxygen were what were left behind (as actually would occur) where the amino group had been? I wouldn't expect you to know this one without looking up the structure of pyruvic acid (see pyruvate at bottom of page 660), but have a look: this sort of thing can get you started making sense of all these seemingly unending and meaningless molecules! Understanding is a lot easier than just memorizing !

Is "free energy" really a form of energy, like electrical energy? (hint: NO) Is it conserved (always stays the same)? Does it tend to increase, or decrease? How are changes in free energy related to changes in entropy? In what sense is disorder measured in units of energy per degree of temperature per molecule? Suppose that there were a certain chemical reaction A+B -> C in which energy were absorbed (i.e. it got slightly cooler as a result of each reaction occurring); then which side of the reaction must have more entropy? The A & B side? Or the C side? Think: what has to change? And what else must therefore also be changing to compensate? Explain your reasoning. Hint, when reactions occur spontaneously, doe that mean that the free energy is increasing, or that it is decreasing? Suppose that you had a mixture of A, B and C, along with whatever enzyme is needed to catalyse the reaction, so that the concentrations of all 3 chemicals were in equilibrium; and then suppose you heat the mixture: in what direction will this shift the equilibrium? Suppose that you added more B to the equilibrium mixture: how would you expect this to change the concentrations of A and C? (these last 3 questions are somewhat hard, but worth them mental effort). Suppose that subjecting the mixture of A, B & C to high hydrostatic pressure (as exists in the deep sea), results in shifting the equilibrium concentrations (for example, more C relative to A and B), when what does this mean about differences in volume between the two sides of the reaction?

Suppose that there is an equilibrium between X and Y, with the concentration of Y being 100-times higher than the concentraction of X; then what must be the difference in free energy between molecules of X and molecules of Y? Can you figure out in what sense a hundred-fold concentration difference equals a certain amount of entropy!? (how much?) Suppose that an enzyme were required to catalyse the inter-conversion of X and Y, but would only allow an X molecule to be converted into a Y molecule on condition that a phosphate became bonded to an ADP to form an ATP at the same time: how could such an enzyme be useful in causeing synthesis of X from Y in living cells? In the presence of appreciable amounts of ATP (and not too high a concentration of ADP), then approximately what sort of ratio of concentrations of X relative to Y could there be? Imagine that the gene for this enzyme were mutated, perhaps resulting in substitution of a glycine in place of a serine at the active site, so that the enzyme would catalyse the inter-conversion of X and Y without any participation of ADP and ATP: explain how that could kill a cell! Suppose that an organism lives somewhere that has a very high concentration of X and a very low concentration of Y, explain how it could use this to generate ATP and drive the rest of its metabolism. For example, how could it use X to drive the synthesis of cellulose? What about the synthesis of RNA? In what way is ATP like money, or like electronically charging costs on a UNC-1 card?

How many micrometers in a meter? In a centimter? In a millimeter? How many millimeters in a centimeter? What is something that is about one micrometer wide? What is something about 10 or 15 micrometers wide? 100 micrometers wide? How many nanometers in a micrometer? An average globular protein is about what diameter? In nanometers? In fractions of a micrometer? What is the maximum resolving power of the best light microscopes, in nanometers? In micrometers? Do you also know the equivalents of the older terms "micron", "millimicron" and "Angstrom unit". About how thick are plasma membrane and organelle membranes?

What is Brownian movement? Do all object undergo Brownian movement? Or just small, light things? Compare the energy of movement of a one-micrometer diameter plastic bead with that of an object weighing 10 times as much! Compare the energy of thermal=Brownian movement of a big molecule with that of a small molecule; and with that of a bacterial cell. What force moves molecules of ATP around the cell, from one location to another? In cytoplasm, about how much time, on the average, is required for an ATP molecule to diffuse 10 micrometers? About how long would it take an ATP molecule to diffuse 20 micrometers? to diffuse 5 micrometers? to diffuse 100 micrometers? At a concentration of one-thousandth of a mole of ATP per liter, about how many times per second would an average-sized protein collide with an ATP molecule? About what is the maximum rate (molecules of ATP per molecule of enzyme) that an enzyme could catalyse a chemical reaction that included breakdown (hydrolysis of ATP to ADP)? Why do these previous two questions have the same answer? When the surface shapes of two kinds of molecules fit each other like a hand in a glove, what happens when diffusion produces a collision between the two? What is meant by recognition, at the molecular level? In this sense, can molecules "recognize" each other even though they have never previously been in contact? What is meant by an "affinity constant", and how does it vary as a function of the degree of complementarity between the shapes of two kinds of molecules? What about the energy binding to molecules together? How is this related to the affinity constant? About how large can affinity constants actually be, for example for binding of hormones to receptors. Who would have had higher affinity constants for that glass slipper: Cinderella, or her step sisters? If they lived happily ever after, does that correspond to a high or low affinity constant between Cinderella and her prince? Or might they be in equilibrium? What about Pluto and Persephone? (who were together only half the time) How is the specificity of enzymes related to their affinity consants for the reactant chemical molecules? The strongest affinity of an enzyme binding site is to molecules having what shape? What are the differences between covalent bonds, ionic bonds and hydrogen bonds? And what are examples of each? Which are strongest? Which weakest? Which of these 3 result from the electromagnetic force? (hint: all 3) What about "hydrophobic" bonding? Why does it depend on the presence of water or other hydrophilic materials, the molecules of which attract each other by ionic and/or hydrogen bonds? If we draw the atomic structures of some molecules, could you make educated guesses about such properties as solubility in water, ability to form hydrogen bonds, where these hydrogen bonds would probably form, and with what sorts of molecular structures they would be able to form hydrogen bonds? What is meant by the primary structure of a protein? How is the primary structure related to the secondary and tertiary structures? What are five general principles for predicting/explaining/determining folding patterns of chains of amino acids? What is meant by a "denatured" protein? What kinds of treatments produce denaturing of proteins? Can the process of denaturation ever be reversed? What class of proteins can catalyse renaturation? What are alpha helices and beta sheets? What causes them to form, and stabilizes them? What are disulfide bonds? Can you figure out how disulfide bonds can tend to resist denaturation of proteins? How can the affinity of some enzymes for their substrates vary as a function of how many molecules of substrate are already bound? How is this related to the "sigmoid kinetics" of those enzymes? And of hemoglobin's binding to oxygen?

Review for second exam summer 2001

Know the structures of glycine, alanine, serine, cysteine, threonine, tyrosine& leucine. What 2 main factors limit the resolving power of a light microscope? (Other than simply how well the lenses are made, or how clean they are, etc.) Approximately when did Ernst Abbe figure out these inherent limitations? In what ways did his ideas change scientists' approaches to seeing smaller objects? Can you resolve shorter distances using red light, or blue light? Why? What are the approximate wavelengths of red light and blue light? What fraction of a micrometer is considered to be the maximum resolving power possible for any light microscope? What is meant by "resolving power" ("limit of resolution") and how is it related to magnification? For example, if you had the choice of either greater magnification or better resolution in a microscope, which would you prefer, and why? What does the term "Numerical Aperture" = NA refer to in microscope objectives? How is NA related to maximum resolving power? What is the maximum possible NA for an objective that isn't some kind of immersion objective, such as oil immersion? In the video of microtubules self-assembling in living cells shown in class, why did only the microtubules glow visibly? (i.e. why weren't other structures and kinds of proteins also fluorescent?) What would Clare Waterman (the person who made that video) have needed to do to make, say, actin fibers glow that way instead? Microtubules are only about 24 nanometers thick, which is much less than the resolving power of light micoscopes! So why was it possible to see the individual microtubules? A thought question: Why did the fluorescent microtubules seem to have a diameter equal to twice the minimum distance that can be resolved? Why would lowering the Numerical Aperature of the microscope objective have made these microtubules look wider (but more pale). In that same video, why did they use tissue culture cells from newts? What is the purpose of embedding cells in some solid material, in preparation for observing it with microscopes? For what purpose are cells embedded in (paraffin) wax? What material are cells embedded into when preparing to observe them by transmission electron microscopy? What is a "microtome"? What are microtome knives made out of in light microscopy? How are diamonds or glass used to cut sections for transmission electron microscopy? Thought question: Why are lead, uranium, osmium and other very heavy elements used to make the stains for electron microscopy, whereas the stains used to create contrast in light microscopy are all carbon compounds with fairly complex structures, instead of heavy elements? Why is electron microscopy capable of resolving much smaller separation distances than light microscopy? What are the lenses made out of in an electron microscope? Why can't living cells or animals be observed by electron microscopy? Why is the increased resolving power of actual modern electron microscopes not as much greater than light microscopes as one might have predicted based on the ratio of effective wavelengths of electron beams as compared with visible light? Incidentally, in light microscopy, mitochondria look like dots; whereas ribosomes are dots by (transmission) electron microscopy. How does scanning electron microscopy differ from transmission electron microscopy? What is meant by phase contrast microscopy? What about "acoustic microscopy"? What is X-ray crystallography used for? Besides X-ray crystallography, what other physical technique is capable of determining the tertiary structures of (small) proteins? (hint: its initials are NMR) What is meant by video microscopy, and how does it differ from light microscopy? (or does it? ) How can light microscopy be used to see objects smaller than its resolving power? What is tissue culture? For what purposes do scientists use chromatography? If you wanted to separate two proteins on the basis of their very small differences in "hydrophobicness", what sort of method would you use? What about separations on the basis of small differences in electrical charge? What about differences in isoelectric point? I once visited some geneticists who were trying to find mutations that affected "wriggling" behavior in roundworms by a sort of chromatography, in which bunches of thousands of the worms were poured into the top of a glass wool column, and then test tubes were used to collect fractions (of a few drops each) at the bottom of the column over the following hour: the method worked! What do you think the basic principle was, analogous to the chromatography of chemicals? How can kinases change the properties of proteins inside cells? For what different kinds of purposes? What is meant by a "ligand"? In the case of enzymes, what is its ligand (or at least one of them, there may be others) If an enzyme bound to some additional ligands, how could that be used for negative feedback control of synthesis of some particular molecule? Hint: what is the distinction between an "active site" and a "regulatory site"? Suppose that a protein binds to two different ligands, A and B; and also suppose that binding to A changes the shape of the protein in such a way that it then has a higher affinity for ligand B; then what can you be sure of about the effect of binding to B, in relation to the protein's affinity for A? What is meant by an allosteric protein? And what are "allosteric transitions"? If a given enzyme is monomeric (only exists in monomeres), then can you draw the approximate shape of the graph describing the variation of relative enzyme activity as a function of different concentrations of the substrate substance? What are meant by dimers, trimers and tetramers? What important difference can be produced in the activity-concentration graph by enzymes being dimers, trimers or tetramers? Conversely, in the case of enzymes that are inhibited by a certain substance, how can the graph of activity versus concentration of inhibitor sometimes be sigmoidal in shape? Why do you think many enzymes evolved to be tetramers of identical subunits? (sometimes only nearly identical, I will admit). Thought question & hint: Figure out why enzymes that have extremely sigmoidal "kinetics" (=variation of rate as a function of substratre concentration) run some danger of dissociating from tetramers into monomeres, and perhaps also some greater danger of denaturing. Which 3 amino acids are acted on by protein kinases; and what structural property do these 3 have in common? What is GTP? How is it used in producing temporary changes in certain protein's conformations? What if such a protein ("GTPase") loses its ability to hydrolyse GTP to GDP? What sorts of effect might you expect to be produced in living cells by some artificial chemical that closely resembles GTP in structure, but that it is impossible to hydrolyse? How are certain kinases and certain GTPases involved in making cells cancerous? Can you suggest possible new approaches to cancer chemotherapy based on the answer to the preceding question? ? How can ATP hydrolysis exert mechanical forces? What are 3 kinds of proteins that actively slide along other protein fibers? What different functions are accomplished by this active sliding? What is ubiquitin? And what would it mean about your immediate future prospects if something came along and attached a lot of ubiquitins to your lysines? How would this be analogous to having arginine as your N-terminal amino acid? What are proteasomes? And how are they related to the cleavage of proteins back to their component amino acids? How many layers of membrane are there making up the nuclear membrane? What are nuclear pores? What is the nucleolus? What is the name of a specific kind of protein that forms a layer just inside the inner nuclear membrane? What happens to this protein when it is heavily phosporylated? When does this occur? What is chromatin, and what 2 substances is it made out of? What is special about lampbrush chromosomes, and where are they found? What is special about polytene chromosomes? What is an example of a kind of animal whose salivary gland cells happen to have polytene chromosomes? What are centromeres? How are centromeres related to mitosis? How many centromeres does each chromosome have? What would be likely to happen if a chromosome had more centromeres than normal? What if a chromosome somehow lost its centromere - what would this chromosome not be able to do (or what wouldn't happen to it)? What is meant by "yeast artificial chromosomes"? What are telomeres? Where are telomeres found? How many telomeres per chromosome? What is telomerase enzyme? Does it make telomeres longer or shorter? What of one of the telomeres were completely lost from a particular chromosome? Why does it makes sense that (many) cancer cells have especially active telomerase enzymes? What is the hypothetical connection between telomeres and aging? (Especially the "senescence" (= aging) of tissue culture cells) About how many base pairs in a haploid human cell? (hint: 3 billion) Why is it therefore somewhat surprising that the human genome project estimate for the total number of human genes is only about 32,000? What are introns? How are introns related to this apparently excess amount of DNA in the human genome, for example relative to bacterial genomes? Of the various different structures and processes mentioned in the paragraph above (telomeres, centromeres, introns, etc.), please review how many are found in animals but not plants, plants but not animals, procaryotes but not eucaryotes, or eucaryotes but not procaryotes? For example, bacteria have circular chromosomes, and no telomeres. What are "domains", in protein structures? Something to think about in eucaryote genes, the boundaries of introns (very!) often correspond to the boundaries between domains; this correlation between boundaries at the level of the gene and at the level of protein tertiary structure makes some sense in relation to the "modules" discussed in the book on pages 216-217; as well as to the speculations on pages 389-391 about evolution of new proteins from parts of previously-evolved proteins. What are "small nuclear ribonucleaoproteins" = snRNPs = "snurps" and how are they functionally related to removal of introns from nuclear RNA, in the formation of messenger RNA for export from the nucleus to the cytoplasm? What are "transposable elements", and about how much of human DNA is derived from them? Except for special exceptions, do differentiated cell types in higher plants and animals contain the same, or different, combination of base sequences? If muscle cells contain the same genes as nerve cells or skin cells, then how do they manage to make different sets of proteins? Is there any overlap between the genes expressed by different cell types? Which sorts of proteins are found in all differentiated cell types, if any? What does it prove that cells can be put into tissue culture from carrots, eventually grown as individual cells, with whole carrot plants eventually being grown from such individual cells? Would this be possible if cell differentiation resulted from discarding that DNA not to be transcribed to make the proteins characteristic of that cell type? Is this analogous to "cloning" of sheep, mice, frogs, etc. from nuclei of individual differentiated cells of adult animals? What differences are there? Are the differences just technical? In what way do the results lead to the same conclusions? Is all control of gene expression at the transcriptional level? What are some other levels of control? In transcriptional control, what function is served by the DNA base sequences "upstream" of the genes themselves? In eucaryotic cells, how far "upstream" can some of these control sequences be? What is the function of the proteins called "transcription factors"? What do they bind to? What has a "major groove" and a "minor groove"? Why do the strands of double-stranded DNA not need to be separated (and the codons exposed) in order for proteins to bind selectively just to lengths of DNA having certain specific base sequences? What are operons? By what mechanism do bacteria temporarily turn on transcription of genes for certain sugar-digesting enzymes only when molecules of this sugar are present (then turning off this transcription when all these molecules have been digested)? How do bacteria use an equivalent mechanism to turn off transcription of genes for enzymes needed to synthesize the amino acid tryptophane? Do transcription factors bind to DNA with high or low affinities? How does dimerization of these proteins sometimes quadruple this affinity? Does this fit in with what you learned before about calculating ratios of reactants and products from the sizes of free energy changes in reactions? What about its relation to what you learned about amounts of energy per hydrogen bond? What are homeodomain proteins, and what effects can be produced in the bodies of Drosophila and other animals by mutations in the genes for this kind of proteins? What are zinc fingers, and what function do they serve in certain transcription factors? Do the zinc ions actuall bind to the DNA, or what? What are "leucine zipper" transcription factors? Do you see any similarity between the functions of leucine side chains as compared with zinc ions in these two kinds of transcription factors? What are "general transcription factors", and how do their functions differ from gene-specific transcription factors? In the "combinatorial control" of embryonic gene expression (p. 427-430; & also 445), how can transcription of certain genes be selectively stimulated just in certain parts of the body? What about expressing a given gene in several different parts of the body? Contrast this with gene control in operons. Suggest how it may be related to large sizes and somewhat distant positions of enhancers in eucaryotes. What is meant by "inheritance" of which X chromosome is inactive in cells of female mammals? (p 446) How can DNA methylation of promoter regions be used to reinforce inactivation of gene transcription? How do daughter cells "inherit" which genes are "turned off" by this mechanism? What are CG islands? About how long is the half-life of a messenger RNA - in procaryotes? In differentiated eucaryotic cells? Can any function be served by shortening this half-life? What are some specific examples, perhaps involving histone proteins? Or perhaps involving effects of steriods? What is the "poly-A tail", and what effect does it have? How can a given gene sometimes code for several different proteins, perhaps differing in length (pages 454, 457, 460) or even differing radically in amino acid sequence (467). What is "genomic imprinting" and how might you expect it possibly to be related to the recently-reported abnormality of gene expression in some or all cloned mammals? (as has been in the news recently)

Review Questions for Third Exam Biology 52 Summer 2001

What does it mean if part of the amino acid sequence of a protein has a region with 18 or 20 or so hydrophobic amino acids in a row? Can the same protein have more than one such region of 20 hydrophobic amino acids? As many as 7 or 8 such regions? Why are the amino and carboxy-terminal ends of a protein on opposite sides of the membrane if a protein has an odd number of such sequences, but not if it has an even number of them? What is special about the secondary structure of the bacterial protein called "porin"? How many separate kinds of membranes do cells have? How many can you list? Do plant cells have more than animal cells? What about epithelial cells? What ion is pumped into cells by the activity of the membrane protein (and ATPase) called "the sodium pump"? Are any ions pumped outward? In which direction are calcium ions pumped? What about chloride ions? What is the source of the energy needed to pump these ions? The resting potential is about how many volts? Which side of which membrane is positive? This resting potential is caused (mostly) by diffusion of which ion through special molecular gates in the plasma membrane? What would happen to the resting potential if the plasma membrane lost its permeability to potassium? What if it became more permeable to sodium ions than to potassium ions? It so happens that increasing a cell's permeablility to chloride ion can increase the resting potential, even to the extent of inhibiting initiation of action potentials: can you figure out why? If you inject a high concentration of a potassium salt into the blood of a person, why will this depolarize their nerves and muscles? Which kinds of differentiated cells have resting potentials? Which can have action potentials? Why do the latter require voltage gated sodium channels in the plasma membrane? About how long do these channels stay open to diffusion of sodium ions, each time an action potential propagates past a given part of a nerve fiber? How do local anaesthetics affect these channels? About how fast do action potentials propagate, or travel? Does this vary between different nerve fibers? What is meant by a refractory period? Suppose that the sodium channels of a given nerve had refractory periods that lasted 9 or 10 milliseconds, can you figure out why the maximum number of impulses per second that could traverse that nerve would be about 100 per second? Suppose that a poison slowed down this nerve's ability to repolarize during this refractory period, so that they couldn't get back to the threshold voltage before the refractory period was over, then can you figure out why that nerve would fire continously 100 impulses per second, more or less forever? Imagine that you had some experimental treatment by which you could lengthen or shorten the refractory periods of sodium channels as much as you wanted: can you predict approximately what ought to happen? (this is worth thinking about!) Suppose that you injected a high concentration of some sodium salt into the tissue around some nerve fibers, can you predict what effect this would have on nerve impulses in the area? What about if you could somehow inject sodium ions into part of the nerve axons - why should this have approximately the same effect as local anaesthetics? Can action potentials propagate only in one direction along a nerve fiber? Or in both directions? Why do these waves of depolarization normally propagate in only 1 direction? What happens when two action potentials meet, traveling in opposite directions? Electric eels, torpedo rays & other kinds of electric fish produce hig voltages by means of specially-evolved muscle cells or nerves that have their sodium channels concentrated into the plasma membrane along one side only (e.g. the tops of cells and not the bottoms), and having hundreds of such cells stacked on top of each other: can you see why this produces large voltages? [with the total voltages = (resting potential + action potential) x number of cells in the stack). or about one volt per ten cells in the stack]

What is meant by chemiosmosis? The energy from reduced NAD and FAD is used to pump which kind of ion in which direction across which membranes of which organelle? In which membrane is ATP synthase located in mitochondria? What about in chloroplasts? Diffusion of what from high to low concentration drives the rotation of the ATP synthase? What is the effect on ATP synthesis and transmembrane voltages if you isolated mitochondria and them put them in a buffer solution that is considerably more acidic than the cytosol? What is meant by "cytosol", anyway? Can you explain how mitochondial function can be short circuited by hydrogen ionophores in the inner membrane of mitochondria? Where would these ionophores need to be to have the equivalent effect on chloroplasts? How do bacterial flagella differ in mechanism from eucaryotic flagella? (besides being a lot smaller) Which gets its energy from ATP; and which doesn't? How is the bacterial flagellar motor closely analogous to ATP synthases? What is the function of cytochromes? (And various other metalloproteins?) What molecules take up the electrons and energy from NADH and FADH? They use this energy to produce what effect? Compare their function in mitochondria with the function of chlorophyll in plants. Except where does chlorophyll get the energy? What about the role of magnesium ions as compared with iron ions? In photosynthesis, does the O2 produced come from CO2 or from H2O, or both, or neither? At what stage is the oxygen split off? And how is NADH involved in this process? At what stage is carbon dioxide "fixed" into sugar? Where does the energy for this come from? Where else? What is ribulose diphosphate? What are the "dark reactions", as compared with the "light reactions"? Can both of them occur in the light? Can both occur in the dark? If chloroplasts had some other source of energy, could they fix carbon without light? In that case, would they release oxygen gas? Why are there probably more tons of "rubisco" enzyme on the earth than any other protein? (besides the importance of its function) What else goes on inside chloroplasts, in addition to photosynthesis? Corn and grasses have a special mechanism for capturing what gas, even at low concentrations? How does this work? Why are these called C4 plants? What is "photorespiration"?

What are the relations between pinocytosis and endocytosis? What and where is the Golgi apparatus? The Golgi is/are especially large and well-developed in cells that do what? What is the difference between rough ER and smooth ER? What causes some ribosomes to attach to membranes of the endoplasmic reticulum? (a thought question) How does this depend on the signal peptides being at the amino-terminal ends of the ER proteins, instead of the carboxy-terminal end? What is the distinction between the "cis" and "trans" faces of the Golgi? What is meant by the KDEL "ER retention signal"? What is BiP, the binding protein? What are lysosomes? What gets broken down in lysosomes? What are storage diseases? What are macrophages? What are "coated pits", "clathrin triskelions", and how do they function in certain kinds of pinocytosis? What about "coatamers"? What is "receptor mediated endocytosis"? In what sense are signals transmitted between nerve cells, and from nerves to muscles, by a form of exocytosis? What are two specific examples of chemicals that function as synaptic transmitters? What are "enveloped viruses", and how have people learned more about membrane fusion by studying them? Why are most membrane proteins so difficult to crystallize? What class of forces are responsible for holding together membrane components, and how is this related to the fluidity of membranes? What class of compounds serve to solubilize integral membrane proteins? What is the "freeze cleaving" technique? And what is it used for? Where does the cleavage plane usually run? Do you thing there is any relation between the location of this cleavage plane and the type of chemical bonding used to hold membrane components together with one another? What are some of the experimetal techniques that are used to demonstrate and to measure the viscosity of membranes, or conversely the amount of diffusion within membranes? Is it good or bad to have cholesterol in your membranes? Do the different kinds of membranes in your cells have the same or different lipid contents? What about integral protein contents; are these the same or different from one membrane to another? What sort of mechanism creates and maintains such differences? How would you need to change a given protein in order to cause it to become positioned in the wrong membrane? Where is glycerol in membranes? Is there any phosphate in membranes? Where? If you know the amino acid sequence of a certain protein, by what criteria could you estimate whether it is a transmembrane protein? ...whether it is a singlepass or a multipass protein? What is meant by a protein being prenylated or myristylated? Why wouldn't you expect prenylated or myristylated proteins to be singlepass of multipass proteins? Where is spectrin found? What is it? What is a glycocalyx? Why do you think it is especially difficult/impractical to transmit signals from one side of a membrane to the other by means of the usual sorts of allosteric changes in conformation? Which molecular properties predispose to permeability through membranes? Which ions have much higher concentrations outside cells than inside? Which have higher concentrations inside? Do you think that it would be possible to have an action potential without first having a resting potential? What is an ionophore? Suppose that you had an ionophore that was specific for sodium ions: What effect would it have on the transmembrane potential to put this substance next to a nerve cell? What about cells of other differentiated cell types? What would be the effect of an ionophore that was selective for potassium ions? What is the sodium pump? Does the sodium pump use appreciable amounts of ATP? Under what circumstances can the sodium pump synthesize ATP, instead of hydolysing it? (and from what chemicals would this ATP be synthsized?). In what way is this process of ATP formation similar to events in the inner membrane of mitochondria? Are there membrane ion pumps for other ions than Na and K? Why are ion pumps always located in membranes (instead of free in the cytoplasm)? What are the similarities and differences between symports and antiports? In the case of epithelial cells lining the intestine, or lining kidney tubules, etc. what is meant by the apical membrane? What is meant by thier baso-lateral membranes? Would you expect that the ion pumps, symports, antiports and other transmembrane channels to be basically the same or different in the apical as compared with the baso-lateral membranes of such cells? If they were different, by what means could they be prevented from simply diffusing into one another and intermingling randomly? If you somehow reversed the usual sodium gradient across a cell's plasma membrane, would the sodium symports and antiports still carry sugar's etc. in the same direction as usual, or just stop working, or what? What is the cause of the human genetic disease cystic fibrosis? What other properties can "gate" ion channels, besides voltage? How does curare work? What about succinyl choline? Is a neuromuscular junction a kind of synapse? How does it differ from the majority of synapses in the body? What are "psychoactive drugs"; and how are many of them related to the mechanisms of synaptic transmission? What is the relationship between "cytosol" and "cytoplasm"? What are the differences between smooth and rough endoplasmic reticulum? About how much of an average cell's total membrane is made up of ER? What about in red blood cells, do you think? What are nuclear pores; and how are they related to the inner and outer nuclear membranes? What are gated transport and vesicular transport; and where do each of these occur? What are signal peptides; and what is the difference between them and signal patches? By what sorts of experimental criteria could you prove that part of a protein was a signal peptide? Why are the signal peptides of nuclear proteins usually not cleaved off of the protein, unlike those of most proteins targeted to other compartments? Why can the different membrane-bound organelles grow only by addition of materials, but not form de novo? Is this true only of those organelles (such as what?) that have their own chromosomes and genes? What are peroxisomes, and what function do they serve? What is believed to be their evolutionary origin? What is meant by "detoxification"? By "glycosylation" ? How are the GTPases ARF and Rab believed to function in controlling the behavior of cytoplasmic vesicles? What is the pH inside lysosomes? What functions are served by having their contents at this pH? What is the pattern of movements of membrane components and of other materials between the Golgi, the ER, and the cell surface? What role does membrane fusion play in infection by some viruses? Example? What is the evolutionary origin of mitochondria and chloroplasts? What is some of the evidence for this? What is a thylakoid and where would you find it? What are some of the differences between the inner and outer membranes of mitochondria? Where is the DNA located in mitochondria? Where in chloroplasts?

#1) What ion is pumped into cells by the activity of the membrane protein (and ATPase) called "the sodium pump"?

#2) The resting potential is about what fraction of a volt, with which side of the plasma membrane being more positive and which side more negative?

#3) This resting potential is caused (mostly) by diffusion of which ion through special molecular gates in which membrane?

#4) Which kinds of cells (normally, unless very sick or dead) have a resting potential? (Nerve cells? muscle cells? epithelial cells? bone cells? leucocytes? gland cells? Egg cells? Which?).

#5) Which of the above kinds of cells are also capable of having action potentials?

#6) About how long do action potentials last? (time)

#7) About how fast do action potentials propagate, or travel?

#8) In order to undergo action potentials, membranes need to possess....
sodium channels.

#9) What do these channels then do (and need to do!) in order to cause repolarization and also cause a refractory period?

#10) Can action potentials propagate only in one direction along a nerve fiber? Or in both directions? Why do these waves of depolarization normally propagate in only 1 direction?

Review Questions for Fourth Exam Biology 52 Summer 2001

What is the distinction between endocrine, paracrine and autocrine signalling by cells? What are neurotransmitters? What sectretes them? Where? To produce what effect? (or possibly what OTHER effect?) What are 2 specific examples of neurotransmitters? What is an example of a hormone whose synthesis can be inhibited by aspirine or by ibuprofen? Can you spell eicosanoid? What is the raw material from which hormone molecules of this class are synthesized? In terms of the materials from which they are synthesized, what do the hormones in the previous question have in common with the "second messengers" DiAcylGlycerol ("DAG") and Phosphoinositol? Cyclic Adenosine Monophosphate (c-AMP) serves what purposes in cells? What is an example of a closely-related molecule that serves a closely related function? What are c-AMP and c-GMP synthesized from? What is a specific example of a synaptic transmitter? Why does this synaptic transmitter only cause a very brief opening of chemically-gated cation channels in its adjacent cell (normally) (hint: How do "nerve gasses" allow the stimulus to continue indefinitely? Would it also be possible to pump synaptic transmitter substances back into the cell that had secreted them, as a method for limiting the time duration of their effect? (hint: yes) Are there any examples of a hormone used in humans and other animals that is a gas? (Hint: NO) How can you cause relaxation of the smooth muscle cells that make up much of the walls of arteries? Are any hormones hydrophobic, in their molecular properties? Can you remember at least two examples? Where are the receptors for hydrophobic hormones usually located in cells, in contrast to the usual location of receptors for hormones that are hydrophillic molecules? Do any hormones, or hormone-like molecules activate tyrosine kinases in plasma membranes? Which general kind? What is prostaglandin? Is there any reason why you ever might want to inhibit its synthesis? Do all kinds of differentiated cells react the same way to a given hormone? Does acetylcholine have different effects on heart cells as compared with skeletal muscle cells? Do any hormones affect the permeability of some cells to calcuim ions? Do any affect GTP binding by intracellular proteins? Which particular protein serves to bind specifically to calcium ions inside cells? What is meant by "adaptation" to a sensory signal? How is this responsible for optical after-images? If you stare at something red for a while, and then look at a white background, what sort of optical illusion do you seem to see? And why? What if you looked at something blue? Try it! How is sensory adaptation analogous to the type of chemotaxis used by bacteria to move to and remain concentrated in areas where there are more food molecules? What about addiction, including drug addiction: in what sense is it related to adaptation to the effects of a given drug? If there were more adaptation, or desensitization, to a given drug, then would that lead you to expect that it would be more addictive? Or less addictive? Compare the force that drives bacterial flagella with that responsible for bending of flagella and cilia in eucaryotic cells? From what does the energy come, in each case? My what sort of proteins is this energy converted into mechanical forces, in bacterial flagella, as compared with (say) the flagella of human sperm cells? By what mechanism can organelles be caused to localize themselves near the centers of cells? How are microtubules involved in this mechanism? What about proteins related to those that drive bending of cilia? What are kinesins? How can they participate in the proper positioning of organelles, such as the endoplasmic reticulum, than tend to move away from cell centers? What is the distinction between "treadmilling" as opposed to "dynamic instability" in cytoskeletal protein fibers? In a thermodynamic sense, how is it possible for self-assembly of protein monomers to be favored at one end of a microtubule or an actin fiber, even though disassembly to form freely-diffusible monomers is favored at the other end? What energy-releasing processes permit this to happen? What is meant by "the plus end" of a microtubule or an actin fiber? What is "the minus end"? Why are dyneins said to be "minus end-directed" motor proteins, whereas myosin and (most) kinesins are plus end directed motor proteins? Can any of the cells of the body craw actively, similar to amoebae? What are some functions that seem to be served by such locomotion? Where does the energy come from in such amoeboid locomotion? What is keratin? What is tubulin? What is colchicine? What effect does colchicine have on tubulin? Are any chemicals that bind tubulin ever used to treat cancer? What are basal bodies? How are they related to cilia and flagella? How are they related to microtubule assembly? How are they related to centrioles and to the formation of mitotic spindles? How are actin and myosin arranged relative to one another in striated muscle cells? What are "sarcomeres"? What provides the pulling force in the contraction of muscles? How does this differ in straited mucles as compared with smooth muscles?

What part of the cell cycle comes right after the G1 period? What about after the G2 period? Where/when (between what and what) in the cell cycle are the three most important checkpoints? What events (at least 3) occur during mitotic prophase? What objects move to what location during mitotic metaphase? What separate from what, and move apart during mitotic anaphase? During what phase of mitosis do the chromosomes decondense, the mitotic spindle disassemble, and the nuclear membrane reappear? When does the "start" checkpoint occur? What effect does damage to DNA in the chromosomes have on this checkpoint? What are the 3 alternative different fates that a cell decides between at the G1-S checkpoint? What gets copied during the S period of the cell cycle? What is apoptosis? Is it the simply the same thing as cell death? Does it serve any useful purposes? If a cell's "start" checkpoint mechanisms are somewhat abnormal and defective, how might that contribute to the cells being cancerous? How could these same defects also make such a cell more susceptible to being killed by certain forms of cancer chemotherapy? What are cyclins? What general class of molecules do cyclins belong to? Are there different kinds of cyclins? When are cyclins synthesized? Are all the different kinds of cyclins synthesized at the same time, or at different times? When are cyclins hydrolysed back to amino acids? Does this happen at the same time for each kind of cyclin? To which particular other proteins do cyclins bind? How does this binding alter the properties of these other cyclins? How does this binding eventually cause breakdown of the cyclins. Which kinds of eucaryotes make cyclins? Yeasts? Animals? Plants? Multicellular species? Unicellular species? All of them? By what sort of mechanism do cells detect that their DNA has been damaged, and not yet repaired? How does this affect the cell cycle? What effects do "anchorage" (attachment and spreading) and cell-cell contacts tend to have on cell growth and progress through the cell cycle? What is the mechanism of the "re-replication block"? What is meant by the "re-replication block"?

Thought questions: (These are more diifficult than standard exam questions: they are also more open ended, and might have many "right" answers, or none! Please read them all and give them some thought) If one protein happened to have the same shape & charge distribution as another one (that is a hormone), even though it had a very different molecular structure, then will the first chemical also act as a hormone? Why or why not? Growth hormone is a protein that has recently become used by dairy farmers who inject it into their cows to double or triple milk production: should people worry about this hormone getting into the milk, and then being taken up by people who drink the milk? What about if a steroid hormone were being used for the equivalent purpose? If a chemical either relaxes contraction of arterial smooth muscles, or inhibits clotting of blood, then is it really a "blood thinner" as people like to say? Would you expect aspirine molecules to be able to diffuse through gap junctions? What about ATP? Cyclic AMP? Calcium ions? Are there any specific cell types that you would you NOT expect to be connected by gap junctions? It is often desirable for cells to sense hormones at very low concentrations, but also desirable for cells to be able to respond quickly to rapid drops in hormone concentrations: explain why it is quite difficult to do both? What is cholinesterase, and why are chemicals that bind to the active site of this enzyme called "nerve gas"? If you had an enzyme that cleaved the one phosphate off of cyclic AMP, how could this block the action of many hormones? If you fused a cancer cell with a non-cancerous cell (these are tissue culture cells, we are talking about here), would you expect the resultant cells to be cancerous or not? By what method(s) might you expect to be able to find out if they were cancerous or not? What would you expect might happen if you fused two tissue culture cells with each other when one of them was in G1 and the other in G2? What about a cell in mitosis with a cell in some other part of the cell cycle, even S period? What could you perhaps have learned from such results about the molecular mechanisms that control the cell cycle? Would you have guessed the correct explnations? Can you invent some OTHER, completely different sort of molecular mechanisms that MIGHT (or could in principle) have served the same functions as the cyclin-dependent kinases? Or is the true mechanism the only possible one, that could work? What if a swimming or crawling cell responds to local decreases in the concentration of a chemical by turning 90 degrees? Would it matter whether this right angle turn toward the right or toward the left? What about if its response were a ten-degree angular turn to the right? Does the angle make any difference? By what experimental criterion should you be able to distinguish whether chemotactic cells are turning in response to lowered concentrations of the "attractant" substance, as opposed to detecting which side of each cell is being exposed to greater concentrations of this substance, and deliberately turning in that direction? What are neural networks; and why are they not really made out of nerves? In what sense can hormones be part of a neural network? If you had to argue pro or con whether it makes sense for eucaryotic flagella to have evolved ones like those in bacteria, which side would you take and what arguments would you make? Protozoa have been discovered that are propelled by commensal=symbiotic bacteria embedded in their surfaces! How might this lead you to compare evolution of cilia to evolution of mitochondria? What are some of the virtues of computer simulations, for the purposes of studying cellular mechanisms? What are some weaknesses, or pitfalls, of computers for this purpose? Why do you suppose that vinblastine and taxol are used for cancer chemotherapy, but cytochalasin isn't. Which checkpoint would probably need to be defective in a given type of cancer cells to make them most susceptible to being killed by vinblastine? How do you suppose that mitosis occurs in the plant species from which colchicine (crocus), vinblastine (periwinkle), and taxol (yew) are extracted? Some drugs can inactivate some checkpoints, at least partially: explain why this tends to increase the mutation rate? Explain why such drugs can make cells more susceptible to the drugs used in cancer chemotherapy? Do you think that such drugs could be of any help in improving cancer chemotherapy? Why or why not? Do you think that cancer results from failures of checkpoints? As opposed to this being a side effect, and not part of the main cause? Could you make lists of mechanisms. processes, events or particular classes of molecules that are found in eucaryotes but not procaryotes? What about procaryotes but not eucaryotes? What about those found equally in both? If cyclins hadn't finally been detected by short term pulse labeling of proteins with radioactive amino acids, then by what criteria or approaches would you expect they would first have been detected otherwise? If a protein is so important, and its shape so delicately-tuned, that any change in its structure will be fatal to the organism, then can the protein be studied by genetic mutations? or by any other molecular methods? Would you expect cells to be twice as big when they have twice the amount of DNA per cell, even when the extra DNA is non-coding "junk"? What might the following (true) facts might mean about the cell growth and cell cycle control mechanisms in nematodes as compared with, say, amphibians (salamanders & frogs)? tetraploid amphibians are the same size as dipliod ones of the same species, but all the tetraploid animals' cells are just about exactly double the sizes of the equivalent cells in normal dipliod animals of that species (which obviously means that the tetraplod animals have half the normal number of cells); in contrast, it has been reported that tetraploid nematodes are slightly larger (maybe 10%) than diploid ones, but have the normal number of cells! Although muscular dystrophy is known to be caused by a defective structural protein in muscle cells, the symptoms of the disease don't appear until a child is about 7 or 8 years old!? What sense does this make, if any? (no one knows!) Would/could knowing the answer to this question be any use in helping to cure this cruel disease? Can you think of any expeimental or other tests for your hypothesis? Can experiments be designed without inventing at least two or more different alternative explanations for the phenomenon being studied? Given one possible hypothetical mechanism for a phenomenon, are there any systematic methods for inventing alternative mechanisms?

MORE Review Questions for Fourth Exam Biology 52 Summer Harris/Strunk

What polysaccharide is the main component of plant cell walls? Where is this material synthesized? (Golgi? ER? Plasmalemma?) What name is given to the regions in higher plants where mitoses are concentrated? What pressure causes expansion of plant cells? How strong can this pressure be? The strength of this pressure is proportional to what varaible(s)? What molecular changes in a plant cell could increase the strength of this force? If a plant lost "turgor", what would that mean? And what could have caused it? What else? (another possible cause) What are plasmadesmata?Where are they located? What kinds of organisms have them? (plants? animals? one-celled organisms?) In what sense could higher plants be regarded as effectively "syncytial"? What kinds of organisms have gap junctions? In what way are gap junctions analogous to gap junctions? In what ways are they different? Describe or draw the arrangement of proteins that are responsible for gap junctions. Where are "tight junctions" formed? What is meant by saying that they are "occluding" junctions? Why do epithelial cell sheets need to have continuous tight juctions encirling their apical ends? Suppose that these junctions were to be lost from some of the cells lining your intestine: what would the result(s) be? Why do epithelial cells need to have different populations of ion pumps, symport proteins, antiport proteins etc. in the apical parts of their plasma membranes, as compared with those in the baso-lateral parts of their plasma membrane? What are desmosomes? What do they look like? Where do they form? What are "adherens junctions"? Which families of molecules are responsible for formation of the adherens junctions? What is meant by "homophilic bonding"? To what molecules would the protein E-cadherin stick to selectively? What about molecules of P-cadherin: what would they stick to? What about molecules of N-CAM? At what location are each of these proteins (E-cadherin, etc.) concentrated? If an embryonic cell stopped making E-cadherin, and then began to make N-cadherin instead; how might this effect its behavior or position? Suppose that a mutation resulted in complete loss of the gene for one of the cadherins: why would that probably result in spontaneous abortion of any embryos in which both copies of the normal form of this gene being lost? What is collagen? Where is it located? What kinds of organisms have collagen? (plants? animals?) Where is collagen located in the organism? (Outside cells? Inside cells? In tendons? Where else?) Is there just one kind of collagen, or what? What is meant by type I collagen? By means of what other specific molecules do cell surfaces attach to collagen? What is integrin? What is fibronectin? What are RGD peptides? What effect can these peptides have on the adhesions of cells to collagen? Thought question: One of the ways that fibronectin was originally discovered was by comparison of two dimensional polyacrylamide gels of cancer cells as compared with equivalent non-cancerous cells: one large extracellular protein was almost missing in many kinds of cancer cells, and was named "Large Extracellular Transformation-Sensitive Protein" = "LETS protein" , later renamed "fibronectin". When higher concentractions of isolated fibronectin were added to tissue cultures of these kinds of cancerous cells, then their shapes and locomotion reverted somewhat to resemble tissue cultures from non-cancerous cells. In what ways does this make sense? Are there any senses in which you would not expect that lack of an extracellular protein would be able to cause cancer? Can you think of several different ways in which new cancer treatments might be invented based on this type of abnormality? What about treatments based on catenins being defective, either in structure or amount, in many cancerous cells? What about treatments based on excessive amounts of tenascin in certain cancers? Another peculiarity of many cancers is the lack of an "organ capsule", made out of type I collagen fibers tightly packed together? What might explain this lack? Can you invent any possible ways to use this abnormality as a means of killing cancer cells, while harming normal cells as little as possible?

What are glycosaminoglycans? What is chondroitin sulfate? How are sulfated polysaccharides related to the turgor or swelling pressure of cartilage (gristle)? How does this differ from the osmotic turgor in plant cells? In what ways is it different? Thought question: If you squeeze a piece of cartilage underwater (or in the body), part of the result will be the generation of a very brief, but potentially quite large, electrical voltage: can you figure out what causes this voltage? Why does it disappear quickly? What is the direction of the voltage (is it + inside the cartilage versus - in the surrounding medium, or the reverse)? Why is another voltage then developed when you quickly release the compressive force on the cartilage? What variables control the sizes of these voltages? What physiological or developmental functions might be controlled by such voltages?

What phenomenon did H.V. Wilson become famous by discovering? Which particular kind(s) of organisms was Wilson studying? Were similar phenomena later demonstrated in higher animals? Whick kinds of molecules are believed to be at least a large part of the explanation for cells' abilities to undergo this phenomenon? Why would you probably NOT expect that the cells of higher plants would be able to undergo any such phenomena? Would you expect cancer cells sometimes to have abnormal cadherins? What about abnormal catenins? What about abnormal integrins? What is the distinction between mitosis and cytokinesis (or cleavage)? Which occurs in animals? Which occurs in plants? Does either one of them differ fundamentally in plants as contrasted with animals? What is the mitotic spindle, or mitotic apparatus? Can you draw it? What protein forms most of its structure? What happens to this structure during prophase? What happens to it during anaphase? What happens to it during telophase? When the chromosomes are all lined up, half-way between the poles of the spindle, what is this called? What sort of forces cause the chromosomes to "gravitate" to this preferred position? How do the effective strengths of these forces vary as a function of position, so as to produce this result? What sort(s) of evidence support this conclusion? Who is Tom Hays? What are kinetochores? What becomes attached to kinetochores? How are kinetochores related to centromeres? What has been discovered about the locations of assembly and disassembly of kinetochore microtubules, by the method of "bleaching" the fluorescence of labeled tubulin in areas between the metaphase plate and one pole of a mitotic spindle?

What is meant by the "Pac Man" hypothesis about the force that pulls kinetochores toward the poles in mitosis? What is the distinction between "anaphase A" as opposed to "anaphase B"? What is meant by "the polar wind" (in the context of mitosis)? What if there were a repulsive force that pushed chromosomes away from the poles of the mitotic spindle, and this repulsion got weaker in proportion to distance, and also suppose that there was an entirely different force that pulled the kinetochores toward the poles of the spindle, and this repulsion force did not vary as a function of distance; can you figure out how this combination of forces could explain Tom Hays' observations on the abnormal X-irradiated chromosomes? Could this explain why chromosomes move to the metaphase plate during metaphase? What sorts of forces would you need in order to explain anaphase B?

Where is a "phragmoplast"? Where (and when and it what kinds of organisms) would it be formed?What was Ray Rappaport's famous "doughnut" experiment? What does this experiment prove about the source of the signals that stimulate formation of the contractile ring? What proteins are this contractile ring made out of? What function is served by the contraction of this ring? What is known about whether these signals strengthen or weaken contractility of actin and myosin in the cell cortex? What are the two main possible kinds of explanations (mechanisms) to explain formation of the contractile ring, specifically the locations where it is formed? How do the drugs colchicine and vinblastine prevent formation or proper functioning of the mitotic spindle? Thought question: Given Danowski's discovery that disruption of microtubules can stimulate/strengthen contractility of cytoplasmic actin & myosin, then can you invent possible mechanisms by which treadmilling of tubulin in the mitotic spindle might be a part of the mechanism causing formation of the equatorial contractile ring? What about controlling the location where the phragmoplast will form?

What is the difference between sexual vesus asexual reproduction? What are some examples of asexual reproduction? What could by a short-term evolutionary advantage to asexual reproduction? What is supposed to be the longer-term advantage of sexual reproduction? What do embryologist mean by "germ cells", as opposed to somatic cells? What are somatic mutations? What are the two kinds of gametes? What is meant by parthenogenesis? How is that different from "budding"? What are testes and ovaries? What are the differences between meiosis and mitosis? What features do they have in common? What is meiosis I, as opposed to Meiosis II? What are chaismata, and what do they connect? What is the synaptonemal complex, and where is it found? What are recombination nodules? When does meiosis occur during sperm development? Contast this with the time of meiosis in oocyte differentiation? Why is the human egg triploid for a few minutes after (normal) fertilization? Why is the human egg NOT haploid, but actually still diploid, at the time it fuses with a (haploid) sperm? What is the acrosome? What is its function? What does it develop from (which organelle)? What are follicle cells, as compared with nurse cells? Which do human eggs have? Where does fertilization occur in frog eggs, sea urchin eggs, birds eggs, human eggs? What is capacitation? What is polyspermy? What are blocks to polyspermy? Why have these blocks evolved? (what is the selective pressure?) How is the electrical depolarization of a fertilized sea urchin egg analogous to the action potential of a nerve fiber? Can you invent 5 or 6 new and different forms of contraception (that might work, in principle)?

The swelling pressure of cartilage is (sort of) a special case of osmotic pressure; in what way does it differ from the osmotic pressure in plant cells? In what ways is it different? If you squeeze a piece of cartilage underwater (or in the body), part of the result will be the generation of a very brief, but potentially quite large, electrical voltage: can you figure out what causes this voltage? Why does it disappear quickly? What is the direction of the voltage (is it + inside the cartilage versus - in the surrounding medium, or the reverse)? Why is another voltage then developed when you quickly release the compressive force on the cartilage? What variables control the sizes of these voltages? What physiological or developmental functions might be controlled by such voltages?

In what sense is cell-cell signalling a prerequisite for evolving multicellular species? Does a given hormone always have the same effect, in cells of a given species? Are hormones steroids or proteins? Or some other kinds of molecules? If one protein happened to have the same shape & charge distribution as another one (that is a hormone), even though it had a very different molecular structure, then will the first chemical also act as a hormone? Why or why not? Are some hormone receptors also transcription factors that specifically activate transcription of certain genes? What else do hormones that use these types of receptors also have in common with one another? Are any of these hormones proteins? Growth hormone is a protein that has recently become used by dairy farmers who inject it into their cows to double or triple milk production: should people worry about this hormone getting into the milk, and then being taken up by people who drink the milk? What about if a steroid hormone were being used for the equivalent purpose? Suppose that you incorporated C14 into the hormone molecules, and then found that the C14 was indeed taken up by mice who drank the milk: would this affect your conclusions in the 2 cases? What is the chemical NO? What secretes it, and what effect does it have? And why is this same effect produced by a certain explosive? And is it really a "blood thinner" as people like to say? {perhaps as opposed to being a "blood vessel thickener"?} What are eicosanoids, and what is a specific example? What is the mechanism of action of aspirin and ibuprofen? Can aspirin molecues diffuse through gap junctions, would you expect? What are some specific tissues and organs where you can find a lot of gap junctions? In what specific cell types would you NOT expect to find any gap junctions? It is often desirable for cells to sense hormones at very low concentrations, but also desirable for cells to be able to respond quickly to rapid drops in hormone concentrations: explain why it is quite difficult to do both? What is cholinesterase, and why are chemicals that bind to the active site of this enzyme called "nerve gasses"? What part of our physiology do many psychoactive drugs act on? What are several examples of "second messengers"? How can you often cause cells to respond in the same ways as they do to hormones, but without using those hormones? If you had an enzyme that cleaved the one phosphate off of cyclic AMP, how could this block the action of many hormones. Why do you think many cancer cells have abnormally low concentrations of cytoplasmic AMP? {this is a true fact, they almost all do} Do you think this could be made the basis of any new kinds of treatment for cancer? What kind of experimental approaches might you use to try to find out whether their low cAMP levels are part of what makes them grow and crawl uncontrollably? What is cholera toxin? What is diacylglycerol, and where does the cell get the components to synthesize it from? Can a cell produce more inositol triphosphate than diacylglycerol? What do you call the class of mutations where alterations that inactivate the protein are nevertheless dominant, instead of being recessive as in most mutations that inactivate proteins? What does the occurrence of such mutants imply about the molecular interactions involved in such a protein's functioning? Would you expect a mutation that deleted to whole gene also to be dominant? P53 mutations are sometimes of this kind, by the way; but not Rb mutations aren't: what do you think this suggests? What is calmodulin? If a mutation altered the amino acid sequence of calmodulin, what sorts of phenotype would you expect this mutation to have? What about a mutation in the gene for adenyl cyclase? Antibodies against hormone receptors can sometimes cause cells to respond just as if the cells had been exposed to these receptors' hormones: how can this be? Sometime such responses will only occur when the antibody molecules have 2 binding sites; and "monovalent" antibodies with the same shaped binding sites fail to mimic the hormone's effect: can you suggest an explanation? How can proteins like Ras amplify a hormone's effect? What change in this type of protein can cause cancer? Do you ever want to hear about sevenless mutations again, as long as you live? What are neural networks; and why are they not really made out of nerves? In what sense can hormones be part of a neural network? What is adaptation; and why is it essential to the type of chemotaxis undergone by bacteria? Suppose bacteria turned every time the concentration of a chemical decreased at their location: what would the net result be? What about if a cell responded to local decreases in the concentration of a chemical by turning 90 degrees? Would it matter whether this right angle turn toward the right or toward the left? What about if its response were a one-degree angular turn to the right? How is addiction related to adaptation? What force drives the bacterial flagella? In what different ways do procaryotic flagella differ from eucaryotic flagella? If you had to argue pro or con whether it makes sense for eucaryotic flagella to have evolved ones like those in bacteria, which side would you take and what arguments would you make? What is nine plus two {other than eleven [which is one more]}? Compare the functions of dynein in cilia as compared with its function in the Golgi apparatus. What functions do kinesin-like proteins seem to serve during mitosis? Suppose that an animal had a mutation that made all its dyneins behave like kinesins, in terms of their direction of force exertion, but were otherwise unchanged: think of as many different likely phenotypic consequences of such a mutation as you can. What are some of the virtues of computer simulations, for the purposes of studying cellular mechanisms? What are some weaknesses, or pitfalls, of computers for this purpose? What is meant by the "plus end" of a microtubule, or other cytoplasmic fiber? What is meant by a plus end-directed motor protein? And what is a specific example, for microtubules? and for actin? Do you think that intermediate filaments have plus and minus ends? Is it a logical necessity that linear polymers have such a difference between their two ends? Could directional transport be achieved if they didn't? What are similarities and differences between cytochalasin, nocodazole and taxol? Why do you suppose that vinblastine and taxol are used for cancer chemotherapy, but cytochalasin isn't. Which checkpoint would probably need to be defective in a given type of cancer cells to make them most susceptible to being killed by vinblastine? How do you suppose that mitosis occurs in the plant species from which colchicine (crocus), vinblastine (periwinkle), and taxol (yew) are extracted? What possible advantage could these chemicals provide to these species of plants? What are the main differences between mitosis in animals and plants? What about cytokinesis; how does it differ in plants as compared with animals? In which organisms does mitosis occur (procaryotes? eucaryotes? ALL eucaryotes? What?) Does the nuclear membrane always break down during mitosis? What are some exceptions? What is the difference between prophase and metaphase? Between metaphase and anaphase? between anaphase A and anaphase B? What is ruffling? What is traction? What do you think is the likely causal relationship between traction and ruffling? What is contact inhibition? What is anchorage dependence? What is the relationship between these last two phenomena and cancer? What are checkpoints? How many do there seem to be? What are the differences between them? What is the result of the relaxation of checkpoints during earliest embryonic development in many species? Some drugs can inactivate some checkpoints, at least partially: explain why this tends to increase the mutation rate? Explain why such drugs can make cells more susceptible to the drugs used in cancer chemotherapy? Do you think that such drugs could be of any help in improving cancer chemotherapy? Why or why not? Do you think that cancer results from failures of checkpoints? As opposed to this being a side effect, and not part of the main cause? What is the z-disk (=z-band)? What are nebulin and titin? What is the relationship between the sarcomere length and the sizes (lengths) of these 2 molecules? What are the striations in striated muscle? What is a difference between heart muscle and skeletal (=voluntary) muscles? Compare the molecular shapes of actin and myosin? In what sense is myosin an ATPase enzyme? In what sense is actin an ATPase enzyme? In what sense is tubulin an GTPase enzyme? What are the similarities and differences between actin treadmilling and the dynamic instability of microtubules? Can you suggest any reasons why MTs don't treadmill? Suggests some possible functions that such treadmilling might serve, for example in mitosis? Suppose that some kind of stabilizing "cap" were added to the minus ends of actin fibers: could this produce a switch to more of a dynamic instability type of behavior? What is the acrosomal filament? How do Listeria bacteria propel themselves around inside cells? Can you invent a form of chemotaxis, in which Listeria would home in on locations in the cell where there was the most oxygen, or something? Where in the mitotic spindle do the contractile ring-inducing signals apparently come from? And what is the main evidence for this? Compare this mechanism with the what controls the location of the phragmoplast. Do you think there is a common evolutionary origin of the plant and the animal mechanisms of cytokinesis? What are cyclins? Are there different kinds with different functions? What do they have in common? When are they made and when are they destroyed? What is the point of destroying them, rather than saving them for re-use? What is their relation to cyclin dependent kinases? What do they phosporylate, when and why? Where is PDGF derived from? What sort of bioassay did Dr. Masui use to identify the chemical nature of MPF? Do you think he expected it to be a cyclin dependent kinase? Is it surprising that yeasts have a very similar protein, considering that they don't have eggs that undergo progesterone-induced maturation? What is PDGF, and where is it derived from? What is the re-replication block? How do you think it works? Which of the following are found in animals but not plants, plants but not animals, both, both with some differences..etc.: Cell walls? Primary cell walls? Secondary cell walls? Meristems? Cellulose? Collagen? Turgor pressure? Plasmadesmata? Gap junctions? Meiosis? Microtubules? Actin? Myosin? Asexual reproduction? Which of the following are found in male animals but not in females; or only in females; or in both sexes? Meiosis? Polar bodies? Germ cells? Gonads? Testes? Ovaries? Somatic mutations? Chiasmata? Acrosomal vesicles? Follicle cells? Nurse cells? What is the difference between follicle cells and nurse cells. What is Down's syndrome? How does its occurrence seem to be related to the long duration of meiosis in oocytes? How does its frequency change as a function of the age of the mother (in humans)? Why do you think that there is not an equivalent change in frequency as a function of the age of the father? Could polyspermy cause Down's syndrome? Is there any type of abnormality of sperm development that actually could result in Down's syndrome? In principle, do you think non-disjunction could occur during sperm development? Suppose that a haploid gamete will die if it has an abnormal number (0 or 2, etc.) of any of its chromosomes, why would the results be different in males than in females? Compare the locations where fertilization normally occurs in different kinds of animals: mammals as compared with amphibians, sea urchins etc. What is capacitation, and why would you expect it to be required only in some of these groups? What is the fast block to polyspermy? What is the slow block? Why is it so important to block polyspermy? Given that increased concentrations of cytoplasmic calcium ions is a commonly-used signal for inducing exocytosis, what is the causal relation between the slow block and the fast block? Why aren't there other types of retarded children that have 3 copies of some of the larger chromosomes? What are some kinds of animals in which the eggs are fertilized outside the body of the parents? Besides mammals, what are some groups of animals in which fertilization is internal? Would you expect there to be such a thing as capacitation in a species with external fertilization? Invent 5 or 6 new and different kinds of contraception, that would depend on interfering with different aspects of early development than the methods of contraception that are now used. What is the difference between nurse cells and follicle cells? Flies have nurse cells and follicle cells: is there any reason to be surprised that they have both? Suppose that the second polar body of a human egg got fertilized by a sperm (in addition to the sperm that fertilized the egg itself): explain how this could result in the formation of a person who was chimeric for many of their genes. (This was the explanation proposed by a former professor in this department to account for certain people born with eyes of different colors, and other oddities). What is the cortical reaction? In what way is it analogous to the acrosomal reaction (=the release=secretion of the contents of the acrosomal vesicle)?

REVIEW BEFORE FINAL EXAM (2001)

What is a nerve growth cone? How is the formation of nerve axons similar to the locomotion of cells from place to place? How is it different? What are 2 or 3 different kinds of control mechanisms that have been considered as possible explanations for the abilities of nerves to reach their proper connection sites? What is the optic nerve? Where are the cell bodies located i.e. the axons from which form the optic nerve. Roughly describe the path of a typical growth cone from a ganglion cell of the retina of a bird's eye. Where does the nerve leave the eye-ball? Does the optic nerve from your right eye ever come near the optic nerve from your left eye? What is the name of structure where these cross? Where do the nerve fibers go from that point? In animals that have stereo vision (hint: including normal cats, but not in Siamese cats!), what happens to the path of some of the nerve growth cones from each eye? What is meant by the "optic tectum"? What is meant by the retino-tectal projection? Are there any other examples of neural projections? If sensory nerves connected to an area of your skin where to have a projection to part of your brain, what would that mean about the relative spatial positions of the connections in the brain? How is selective cell-cell adhesion thought to control formation of the retino-tectal connection? If connections of optic nerve axons to the tectum were controlled by some form of absolute point-to-point specificity (as the textbook seems to imply), then what ought to happen if half of the retina were surgically removed before the optic nerve were formed? (I.e. where would the ganglion cell axons from this half-retina connect? Hint: to what area would none of them be expected to connect?) Conversely, suppose that the posterior half of the optic tectum (part of the midbrain) were surgically removed from a developing embryo before the optic nerve formed, then can you suggest several possible alternative results concerning the spatial pattern of connection of retinal ganglion cell axons to this remaining part of the optic tectum? In particular, what about the behavior to be expected from the growth cones "growing" back to the brain from the anterior half of the retina? What if you removed the posterior half of the tectum, and also removed the posterior half of the retina: might the textbook predict that NO projection would be formed? (since the anterior retina normally connects to the posterior tectum, and the posterior retina connects to the anterior tectum: so if the posterior 51% of both are removed, then none of the remaining ganglion cells would be able to connect to the part of the brain their growth cones would normally have migrated to!) Is chemotaxis ever able to guide the paths of nerves? Can you invent any system by which chemotaxis, perhaps responding simultaneously to combinations of several different attractant substances at the same time (with additive effects!?) could be able to produce two dimensional neural projections, such as the retino-tectal projection? This is an unsolved problem, even at the level of computer simulations!! Suppose that you surgically grafted an optic tectum to an abnormal position in the brain of an embryo, would you expect that the optic nerve fibers could still connect to it, regardless of where you put it (within reason - somewhere in the head)? Could that tell you anything about whether the ganglion cell growth cones were guided by chemotaxis, or by some other type of mechanism? What is apoptosis? Is it the same as cell death? (Are all cell deaths apoptotic? or just certain ones?) What are several specific examples when or where apoptosis occurs? What causes the webbing of a duck's feet? Why isn't there a webbing between the fingers of our hands? Is apoptosis used to resist virus infections? Some kinds of viruses, including the kind that causes "mono" have viral genes that code for a protein similar to the normal bcl-2 proteins of humans: suggest how this helps the virus. What are caspases? What do they digest? Where are they located? In what organism was the first caspase discovered? How was this discovery made possible by the deliberate isolation of mutant animals with certain phenotypes? Would there have been any (practical) way to discover caspases by means of mutations in human genes? What a human mutation that caused webbing between fingers, lowered resistance to viral diseases, and high rates of autoimmune diseases and lymphoma: how might these abnormalities all result from the same sorts of mutations? What are osteocytes? What are osteoclasts? Suppose that you invented a drug that selectively killed or inactivated osteoclasts, without disturbing osteocytes: how might such a drug be used to treat osteoporosis (weakening of bones in women and astronauts, etc.). If put in DC electric fields, most differentiated cells either align perpendicular to the votage gradient, and/or crawl perferentially toward the negative electrode; but osteoclasts and macrophages react to electric fields by migrating toward the positive electrode; no one has any good ideas why they should differ in this way; can you think of any? What is the special advantage of cartilage, relative to bone, in a growing embryo? How is the swelling of cartilage related to osmosis & osmotic pressure? Why is no semi-permeable membrane necessary in the case of cartilage? (In contrast to ordinary osmosis, for example in plant growth) Functionally, why is the human skeleton mostly made out of cartilage at first, with this cartilage gradually being replaced by bone as we get older? Premature ossification (bone formation) of cartilage is the cause of an important class of human dwarves: can you explain why this is? What happens to bone that is subject to mechanical loads that are larger than usual? What about if bones are not subjected to normal-sized loads? Is bone a static tissue, that (once formed) is never changed or replaced: Or is it dynamic? What external factors influence bone deposition and destruction? How is cartilage involved in the repair of broken bones? What is allergy; and how is it related to immunity? What are autoimmune diseases? How are autoimmune diseases related to allergy, and to immunity? How are antibodies related to immunity? What is the distinction between acquired (or active) immunity and passive immunity? Based on what you learned in lecture, when a vaccine stimulates your body to produce antibodies against a particular antigen, is this by somehow creating the antibodies or the cells that make them; or is it by stimulating growth, multiplication and secretion of antibodies by cells that were already present, and already had the specificity of making antibodies against that antigen? At what stage of your life do lymphocytes acquire the capacity to make antibodies with a certain shaped binding site? Does this occur before or after you are exposed to antigens that will fit that particular binding site? Does it depend upon, or is it independent of, your exposure to antigens that will fit the binding site? What are B-lymphocytes? What are T-lymphocytes? Which of these two kinds of lymphocytes syanthesize and secrete antibodies? How can antibodies that bind to different antigens be coded for by different DNA base sequences? In what sense were these base sequences already present in the fertilized egg? In what sense are these sequences created during embryonic development?

How is the creation of the genes for antibodies analogous to the crossing over that otherwise occurs only during meiosis I? If neither you nor any of your ancestors were ever exposed to antigen molecules having a certain shape, would your immune system nevertheless be able to make antibodies whose binding sites would exactly fit these antigens? What are some specific examples of autoimmune diseases? (please know at least two examples) How is the immune system related to autoimmune diseases? Many or most of the drugs given to people to treat their autoimmune diseases also suppress these people's resistance to germs: can you briefly explain this? Can you deduce what effect these drugs would have on the people's allergies, if any? Actually, most cancer chemotherapy inhibits allergies: can you figure out why? Do you know the difference between antibodies and antibiotics? Which are proteins secreted by a certain cell type in vertebrates? Which are made by microorganisms, and used as drugs in the treatment of diseases? How many binding sites does each antibody molecule have? (At least ? & sometimes as many as ?, for certain kinds of antibodies). What (would you guess) is meant by the "variable sequence region" of an antibody molecule? What about the "constant sequence region? Guess which corresponds to the binding site! How is the variable sequence region of the antibody gene generated during embryonic development: by what sort of process? What is meant by the V, D and J regions of the variable sequence region of antibody genes? Given that each antibody molecule has light chains and heavy chains (as many of each as it has binding sites, incidentally!), and also given that the light chain variable sequence region is made out of a V region joined to a J region joined to a C (constant sequence) region, whereas each heavy chain's variable sequence results from combination of a V a D and a J, then how many different combinations are possible, if there were 100 different V regions, 10 D regions and 5 J regions? 100 x 10 x 5 x 100 x 5 = 5000 x 500 = 2,500,000. Please make sure that you understand the principle here: If you randomly drew hands of cards with one diamond card, one hearts card, one spades card and one clubs card, then the total number of different combinations of these would be 13 x 13 x 13 x 13 = 28, 561: so what if there were a certain DNA base sequence (like CGATTGGGCCATTGGGCGAAT) corresponding to each of the 52 different cards in the deck, and if there were some molecular recombination mechanism that randomly selected one of the 13 alternative "diamonds" sequences, etc. and bonded it to a randomly selected one from among the 13 alternative hearts sequences, etc. then this "generator of diversity" would give a total of twenty eitght thousand, five hundred and sixty one alternative variable sequences; and if each of these splicing events were a little sloppy, and could occur at any of 2 or 3 sites, then that would create 16 to 81 times as many different variable sequences: right? (2 to the fourth power is 8) How are "T-cell receptor" proteins analogous to antibodies? Where are they located? What kind of cell secretes antibodies? What is meant by passive immunity? If you get bitten by a poisonous snake, what sort of antibodies ("antivenin") will be used in your treatment? If you wanted to become (immunologically) immune to bites of poisonous snakes, then what would you inject yourself with? If you had been bitten several different times by a certain kind of poisonous snake, then would you expect the pain & swelling to get worse and worse with each bite, or the opposite? Conversely, why might your reactions to the "antivenin" become more and more severe, each time you had to be injected with it? If you had the same blood type as another person, and you had been bitten several times by a certain kind of poisonous snake, then how could this other person be treated for snakebite using a transfusion of your blood? What are histocompatibility antigens? Where are they located? Is it their function to prevent successful grafting of skin, kidneys etc. from one person to another? What happens to tissue grafted from one person to another, when their histocompatibilty antigen proteins have slightly different amino acid sequences? Transplantations of bone marrow cells include b-lymphocytes and t-lymphocytes; and if bone marrow is transplanted into a person whose other tissues differ in their histocompatibility antigens, then all that person's cells will be attacked by t-lymphocytes; this is called "graft versus host disease"; can you figure out what is going on, and how this differs from what happens when a person gets, say a skin transplant or a heart transplant from a person with differing histocompatibility antigens? What is immune tolerance? What is a possible mechanism that might explain this tolerance? How is tolerance related to autimmune diseases? If you could deliberately induce immune tolerance to any given antigen, then how could you use this ability to treat what kinds of diseases? If a germ (either virus or bacterium) could induce immune tolerance to itself, then how could that help the germ? It has been reported that introducing extra copies of the bcl-2 gene into mice results in autoimmune diseases: what does this suggest about the fate of anti-self b-lymphocyte and t-lymphocyte clones? Non-Hodgkins lymphoma and lupus tend to run in the same families: does THIS suggest anything about the previous question? If there were only a few alternative histocompatibility antigens (analogous to the few alternative antigens on red blood cells, A, B & O) then how would this make tissue grafting easier? How would that make it easier for viruses to escape attack by the immune system? People having certain ones among the normal different (type II) histocompatibility antigens are found to have greatly increased rates of certain autoimmune diseases: no one knows why this is; what the alternatives are, nor what experiments should be done to chose between the alternatives! Can you invent any way to cause the cancerousness of cells also to procuce changes in the shapes of their histocompatibilty antigens? For example, imagine treating people with peptides that cancerous cells would be able to cleave into fragments, but normal cells wouldn't cleave; with the resulting fragments then being held by type I histocompatibility antigens! How would that enable the t-cell side of the immune system to fight cancer? How is cancer related to cell growth? How is it related to cell locomotion? Could cells be cancerous if they didn't grow rapidly? How about if they didn't crawl rapidly? What about if they didn't grow and divide at all? What about if they had no ability to crawl? Can any form of cancer be produced by a lack of apoptosis? Can cancers ever be caused by infectious viruses? Are any forms of human cancers caused this way? What is believed to be the main cause of human cancers?

What are oncogenes? What are "antioncogenes"? How were the first oncogenes discovered? Do the oncogenes themselves have to become mutated in order to cause cancer? What about an increase in the number of copies of a normal oncogene? What about a mutation in the promoter or enhancer regions that control transcription of an oncogene? Could that cause cancer? (Hint Yes: question: how?). Do any oncogenes code for tyrosine kinases? What about GTPases? What about receptors for growth factors? What about transcription factors? (hint: yes, yes, yes, yes). For each of these 4 classes of proteins, figure out what sorts of changes might be expected to produce cancer! Why is it NOT TRUE that cancer could be eliminated by removing the oncogenes from the chromosomes? What is wrong with the often-stated idea that "oncogenes serve to cause cancer", or the idea that "oncogenes are inactive until some rare event that turns them on"? Would you expect yeasts or other one-celled organisms to have genes very similar in base sequence to human oncogenes? Would you guess that these are often some of the most conservative genes, evoluionarily? (they are) What is meant by carcinomas and sarcomas? How do they differ from each other? What about lymphomas? For which differentiated cell types are there no (or very few) cancers? Why? Most chemotherapy drugs act how? Why is it somewhat paradoxical that these drugs cure as many people as they do? Suppose that cancer cells have defective checkpoints (in the cell cycle)? What sense does it make that defective checkpoints could allow uncontrolled growth? What sense does it also make for the defectiveness of these checkpoints ALSO to make the cells more susceptible to being killed by drugs that disrupt some of the cell properties "checked" by the checkpoint mechanisms? What is gastrulation? How is gastrulation related to the subdivision of the embryo into ectoderm, mesoderm and endoderm? What sort of process is gastrulation? Does it make sense that gastrulation and neurulation are both inhibited by poisons that bind to actin and block its assembly and treadmilling? What are the 3 primary germ layers. What are the primordial germ cells? Why might chemotaxis, of some kind, be used by primordial germ cells? Which two kinds of differentiated cells develop from primordial germ cells? What are two organs or tissues that develop from each of the 3 primary germ layers? What is neurulation? How is neurulation related to the decision as to which embryonic cells will form nerve cells, instead of forming the outer layer of the skin? What variables can control subsequent establishment of the anterior-posterior and dorso-ventral axes of the body? Are there any kinds of animals in which both these axes are determined during oogenesis? Are there any kinds of animals in which one axis is determined during oogenesis, and the other is decided by where the sperm fuses with the oocyte? Is the direction of gravity ever the controlling factor for any of these axes? Are there any kinds of animals in which neither axis is decided until the embryo has divided into many cells? What is the distinction between regulative development and mosaic development? In which can you split the embryo at the 2 cell stage, or even later, and have each of the fragments develop into a normally proportioned animal? What are some examples of kinds of animals whose development is very regulative? What are some examples whose development is very mosiac? If both a-p and d-v axes were established during oogenesis, then what would that imply about whether development will be mosaic or regulative? What do enbryologists mean by "induction"? Spemann discovered that development of what organs can be induced by grafts of the tissues that form what other organs? What did this imply about the control mechanisms in normal embryonic development? What is meant by ooplasmic segregation (=cytoplasmic segregation), for example in development of snails and sea squirts? How is this related to the mosaic-ness of development in these species? How is this similar, but also how does it differ, from the establisment of a-p gradients of bicoid protein and d-v gradients of dorsal protein (in fly oocytes)? What are hox genes? What kinds of animals have them? In which kind of animals were they originally discovered? What kind of proteins do hox genes code for? Mutation of hox genes produce what kind of phenotypic abnormalities in flies? How does the spatial arrangement of hox genes differ on human chromosomes as compared with their arrangement on fly chromosomes? What it the usual spatial pattern of transcription (and likewise of protein synthesis) of these genes in developing vertebrate embryos? What interesting parallel is there between this anatomical pattern of expression as compared with the relative location of the genes on the chromosomes? What do people mean by "colinearity", in relation to hox genes and their anatomical patterns of expression? What do people mean by "morphogen" substances? What is a specific example of a hypothetical morphogen? Why couldn't a large protein like bicoid possibly be a morphogen in mammal eggs? What about in frog eggs? (especially for one of their axes, if possibly not the other!) Could cytoplasmic segregation involve morphogen substances? If development of one of the axes of the body did depend on a morphogen, then what phenotypic effect would you expect to be produced by the mother animal ingesting some drug that contained the morphogen substance?

Review Questions for Biology 52 2000 Albert Harris
(if you know all these answers, you are sure to get an A!)

Could you identify which class of compounds a certain chemical belongs to, based on a drawing of the atomic structure? Which amino acid structures do you know? Within these structures, do you know which parts form peptide bonds to the neighboring amino acids? And could you draw the structure of a peptide made of methionine, proline, glutamic acid, with the methionine forming the "N-terminal" amino acid of the peptide? What about drawing the structure of these same 3 amino acids, except with the methionine being at the carboxyl end? Is there anything especially strong or energetic about the phosphate bonds in ATP? Why, or why not? If its bond energy were higher than that of a carbon-carbon bond, would that make ATP more or less useful? What is feedback inhibition, and what functions can it serve? Why does the rate of chemical reactions increase more than linearly as a function of temperature? What coenzyme is used to transfer carboxyl groups? Explain why the addition of citric acid, and certain other related compounds to mixtures of the enzymes responsible for the Krebs (citric acid) cycle, seemed to behave like enzymes themselves insofar as increasing the rate of oxidation of pyruvate. Explain why adding either aspartic acid or glutamic acid has this same effect. What are 10 different kinds of examples in which biological processes are controlled by precise complementary fitting between one molecule and another? Is it essential that the charge distributions be complementary too; or is shape sufficient? Could you have (in which of these 10 examples, do you have) complementary patterns of charge distributions, but not complementarity of shape? What are hydrogen bonds? Can you draw the molecular structures of a pair of chemicals that should be able to form a hydrogen bond from one to the other? In what way are hydrogen bonds a special case of bonding between + and - charges, as betwen ions or ionized side chains? What are hydrophobic bonds? Are they an example of electrical bonding between + and - charges? In what sense are hydrophobic bonds also an indirect result of electrical bonding between + and - charges? If you could magically strengthen the forces of attraction between all the + and - charges in a system, what effect would this have on all the hydrophobic bonds acting in that system? Is it possible for the binding site of an antibody to catalyse a chemical reaction? What about for some other part of the surface of an antibody to catalyse some chemical reaction? Can RNAs be enzymes? What evolutionary hypothesis has been suggested by the answer to the previous question? Do you suppose that an RNA could act as a hormone? Could RNA act as the genetic material for an organism, instead of DNA? In what sense is osmotic pressure analogous to transmembrane potentials (like the resting potential)? How much force can osmosis exert, for a given concetration difference across a semi-permeable membrane? Suppose you have a non-permeable membrane: can an osmotic pressure be generated across it? What about across a membrane that is freely permeable, not just to water, but also to all the materials dissolved in that water? The swelling pressure of cartilage is (sort of) a special case of osmotic pressure; in what way does it differ from the osmotic pressure in plant cells? In what ways is it different? If you squeeze a piece of cartilage underwater (or in the body), part of the result will be the generation of a very brief, but potentially quite large, electrical voltage: can you figure out what causes this voltage? Why does it disappear quickly? What is the direction of the voltage (is it + inside the cartilage versus - in the surrounding medium, or the reverse)? Why is another voltage then developed when you quickly release the compressive force on the cartilage? What variables control the sizes of these voltages? What physiological or developmental functions might be controlled by such voltages? Why do you think electric eels don't work this way (or any of the other, independently evolved, kinds of electric fish, either)? Incidentally, do you know how electric fish do generate their voltages? What would you guess? What if I told you that one kind of electric fish has flattened, muscle-like cells, in which all of the voltage gated cation channels are localized to just one side of each cell, with all these sides facing in the same direction (oriented sort of like the batteries in a flashlight, and for the same reason)? If you were to double the concentration difference across a semipermeable membrane, by what fraction would that make the osmotic pressure increase? Could you have an osmotic pressure generated by differences in the concentration of a charged molecule? Is your brain full yet? Are the physical and chemical properties of macromolecules usually the same or different from those of the monomers of which they are made? Give some examples. What are some different kinds of chemical bonds? Which are strong and which are weaker. Is there any relationship between bond energies and bond strengths? Is the "high energy" phosphate bond in ATP especially strong? If it were stronger than, say, an average C-C bond, what would the result be? Draw the spatial arrangement of atoms in a typical hydrogen bond. Suppose that a sugar binds to a protein, and that there is an equilibrium between bound and unbound sugar: is there any predictable relationship between the bond energy of the sugar-protein bonds and the ratio of bound sugar to unbound sugar? Suppose that there is some way to increase the bond energy: what mathematical relation applies to the predicted changes in the ratio of bound to unbound sugar molecules. Suppose that an enzyme binds to 2 substances, A and B; and suppose that an enzyme with a molecule of A bound to it develops a stronger bond energy for binding to B; what can you predict from this? About how the enzyme's affinity for A will be changed by binding to molecules of B? About whether the binding sites for A and B are near each other or far apart? About whether catalysis of changes in A can be made dependent on simultaneous changes in B, or vice versa? What is meant by an allosteric change? What is meant by a cooperative allosteric change? What are the differences between the primary structure of a protein, the secondary structure of a protein and the the tertiary structure of a protein? What is meant by denaturing a protein? What can cause this? What class of proteins can help to repair it? What is meant by an alpha helix? What is a beta sheet? Hydrogen bonding between which parts of of the protein chain cause/stabilize these two types of structures? Why do you think that those parts of proteins that pass through plasma membranes consist almost entirely of hydrophobic amino acids, and are always arranged as an alpha helix? Where do the side chains of hydrophobic amino acids tend to go when a chain of amino acids folds up? What is another name for a folded chain of amino acids? Where do the charged amino acids tend to wind up after folding? What is a specific example of a hydrophobic amino acid? Can you explain why those mutations that substitute a negatively charged amino acid for a positively charged one tend to be less damaging than those that substitute a hydrophobic amino acid for either a positively charged one or a negatively charged one (sickle cell anemia being an example)? Does it make sense that this would be much less true if the substitutions were at the active site of an enzyme? Which class of amino acid side chains would you expect to be concentrated at the binding site of an antibody against some lipid substance? What about the binding site of an antibody against DNA? Or can such things exist? What is a disulfide bond? Which amino acid participates in it? Why do you think mercaptoethanol is used in SDS gels? What would it mean if SDS-PAGE gave you a very different measurement of a protein's molecular weight, depending on whether mercaptoethanol was included? Would you expect the molecular weight to seem higher or lower as a result of leaving out the mercaptoethanol? If 2 proteins had about the same molecular weight, but one was globular and the other was fibrous, which one would be longer? Although actin is a globular protein, it forms fibers: how is this possible? Is there any way to change the relative energy levels of 2 compounds? What about changing the activation energy for converting one into the other? If a protein were to accomplish this latter task, what name would you use to refer to that protein? Basically, what properties would a protein need to have in order to do that? How can such a protein cause a compound to undergo a chemical reaction that would raise it to a higher energy level? What is the distinction between magnification and resolution? What 3 main factors limit the resolving power of a light microscope? Approximately when did Ernst Abbe figure this out? In what ways did his ideas change scientists' approaches to seeing smaller objects? Why is electron microscopy capable of resolving much smaller objects than light microscopy? What are the lenses made out of in an electron microscope? Why can't living cells or animals be observed by electron microscopy? Is the resolving power of actual modern electron microscopes much more than, the same as, or much less than would have been predicted on the basis of Abbe's reasoning? What is the limiting factor? What is the main obstacle to building an X-ray microscope? What is X-ray crystallography used for? Approximately what it the resolving power of X-ray crystallography? Besides X-ray crystallography, what other physical technique is capable of determining the tertiary structures of (small) proteins? How does scanning electron microscopy differ from transmission electron microscopy? In the photographs in the textbook, approximately what are the sizes of the smallest objects any of them resolve? What are specific (biological!) examples of each of the following: Something that is about one mm. in diameter? Something that is about one thousand nanometers in diameter? Something that is about ten nanometers thick ? Something that is about one nanometer in width? Something that is about ten micrometers in diameter? Something that can barely be seen in a light microscope? How many Angstrom units in a micron? What are the approximate wavelengths of different colors of light? What is phase contrast microscopy? What is meant by video microscopy, and how does it differ from light microscopy? What is the limit of resolving power for video microscopy? Can light microscopy be used to see objects smaller than its resolving power? If it could see them, what couldn't it do? What is tissue culture? Can just animal cells, or just plant cells, be cultured successfully? The salts, acidity and nutrients of tissue culture media are designed to approximate what? What is the difference between a primary culture, a secondary culture and an established cell line? What is a specific example of an established cell line? Can human cells be cultured, or only animal cells? Would you expect that different culture media would need to be used for human cells than for animal cells? Would you expect that plant tissue cultures would need different media than animal cells? Can cells continue to maintain their differentiated state in tissue culture? What is meant by senescence, in regard to tissue culture cells; and what is its relationship to cancer? What is serum, and why does it usually need to be added to animal cells' culture media? In "serum free media" what sorts of substances would need to be added to substitute for serum? What is meant by cell fusion? What kinds of cells can be fused? What are some of the experimental questions than have been asked using cell fusion? How is cell fusion used in making monoclonal antibodies? Do individual monoclonal antibody molecules bind any more tightly to their antigens than do individual polyclonal antibodies? Is it possible to have a fluorescent monoclonal antibody? What are fluorescent antibodies used for? Would it be possible to make a fluorescent antibody that would bind specifically to antibody molecules from a certain other species of animal? What use could be made of these? For what sorts of experimental purposes are certain proteins, like tubulin, isolated and then covalently bound to fluorescent molecules? What is the advantages and disadvantages of labeling proteins themselves with fluorescent tags, as compared with using fluorescent antibodies to locate their positions? What are fluorescent probes? What is the principle behind using such a probe to determine the concentration of free calcium ions inside the cytoplasm of a living cell? What other properties of cells could be mapped in this same basic way? For what purposes do scientists use chromatography? If you wanted to separate two proteins on the basis of their very small differences in hydrophobicness, what sort of method would you use? What about separations on the basis of small differences in electrical charge? What about differences in isoelectric point? I was visited some geneticists who were trying to find mutations that affected "wrigling" behavior in roundworms by a sort of chromatography, in which bunches of thousands of the worms were poured into the top of a glass wool column putting, and then test tubes were used to collect fractions (of a few drops each) at the bottom of the column over the following hour: the method worked! What do you think the basic principle was, analogous to the chromatography of chemicals? How can kinases change the properties of proteins inside cells? For what different kinds of purposes? Which specific amino acids are phosphorylated, and why just them? What is GTP? How is it used in producing temporary changes in certain protein's conformations? [And, remembering last weeks quiz, what other important function is served by GTP?] What is such a protein loses its ability to hydrolysed GTP to GDP? What sorts of effect might you expect to be produced by some artificial chemical that closely resembles GTP in structure, but that it is impossible to hydrolyse? How are certain kinases and certain GTPases involved in making cells cancerous? Can you suggest possible new approaches to cancer chemotherapy based on the answer to the preceding question? What is a cyclin dependent kinase? How might they be involved in cancer? What about in new types of method for treating cancer? How can ATP hydrolysis exert forces? What are 3 kinds of proteins that actively slide along other protein fibers? What different functions are accomplished by this active sliding? People used to assume that muscle fibers and fibers in cilia, etc. actually contracted, rather than sliding: would that have been possible, in terms of the properties of proteins? Why do you think sliding evolved instead? What is ubiqitin? And what would it mean if something came along and attached a lot of them to your lysines? Would this be worse than having arginine as your N-terminal amino acid? How many layers of membrane are there making up the surface of the nucleus? What specific protein forms a layer just inside the nuclear surface? What happens to this protein when it is heavily phosporylated? When does this occur? What is chromatin, and what 2 substances is it made out of? What is special about lampbrush chromosomes, and where are they found? Ditto for polytene chromosomes? How many centromeres, and how many telomeres, would be found in a normal human cell? (our haploid chromsome number being 23) What would be the result of removing a centromere from one of these chromosomes? What about the effect of removing a telomere? What about the effect of adding an additional centromere? About how many base pairs in a haploid human cell? How does this compare with other kinds of animals and plants, more or less? What are nucleosomes? And what are they made of? Does their presences interfere with replication; with transcription; with mitosis? Of the various different structures and processes mentioned in the paragraph above, how many are found in animals but not plants, plants but not animals, procaryotes but not eucaryotes, or eucaryotes but not procaryotes? What are "domains? What are "motifs"? In which class of macromolecule is each found? Can you imagine a domain that was also a motif? Which one is more real; and which one is more of a conceptual term? What kinds of materials are used for staining in electron microscopy? Do you think antibodies would be of any use for EM staining? How would the antibody molecules need to be modified? Suppose that anlibrium exists in the conversion of A to B, and that the volume of B is somewhat smaller than substance A: what effect would high pressure (such as deep under the sea) have on this equilibrium? What about if you had to pass through the activated state "C" to get from A to B, and the volume of C was larger than either A or B? If there were a 1:1 ratio in the relative amounts of A and B in equilibrium with each other, what does that mean about their free energy difference? What are some examples of differentiated cell types? Do differentiated cells express housekeeping genes, or only luxury genes? What would happen to a cell if you somehow removed or inactivated all the luxury genes? What if you did the same thing to all of its housekeeping genes? What kinds of evidence prove that all differentiated cells contain the same genes as all the other differentiated cells? Are there any special cases that are exceptions to this rule? What are 2 or 3 such exceptions? What is the difference between transcriptional control of gene expression and translational control of gene expression? Which one is less 'wasteful'? How can the the amount of a protein that is synthesized be controlled by altering the stability of messenger RNAs? What factors can control this stability? If the amount of a given protein that was made in a certain case turned out to be controlled by a homeodomain protein that binds to certain base sequences in the DNA, then which of the different levels of control would this be an example of? What are are several different classes of transcription factors? And what are the differences between them? Which one of these has the homeodomain proteins as a subclass? What is the principle of the gel mobility shift assay? What is its purpose? What is another technique that is used for the equivalent purpose? What kinds of organisms have operons? What is a specific examples of an operon? What functions do operons serve? Are any transcription factors involved? At which level of control (translational, etc.) do operons control gene expression? What are some of the main differences between the operon type of control of gene expression, as opposed to that responsible for differentiation (permanence, especially)? What are the similarities, and what are the differences, between promoters and enhancers? Would you expect many of all houskeeping genes to have similar base sequence in their promoter regions? What about different luxury genes that are cvo-expressed in the same differentiated cell type? What if an evolutionary change occurred that moved a certain promoter sequence to the position just upstream of the gene for a transcription factor that binds specifically to this promoter? Why can a gene have several enhancers, but only one promoter? What if the promoter for one structural gene were somehow mutated so that it acquired approximately the same base sequence as that found in the promoter for some other gene? What effect would this have on the expression of gene #1 above? Could it have any effect on the expression of gene #2 (the one whose promoter sequence #1 now resembles)? A given differentiated cell will express many different structural genes: would you expect the base sequences of the promoters for these different genes often to be rather similar to one another? What about the promoters for housekeeping genes? Explain how cancer can result from breaking a chromosome and rejoining the DNA strands at the wrong place? (And why is cancer frequently the result of rejoining one gene to the promoter of a different gene? Can you suggest any molecular biological ways to treat cancers that result from such translocations? Can you have a promoter region near the structural gene for a transcription factor? Would it be possible for a transcription factor to bind to the promoter of its own structural gene? What consequences could result from this? Or what sort of function could be accomplished? Which are more apt to have their cytosines become methylated: luxury genes or housekeeping genes? Why are only those cytosines that are next to a guanine methylated? What is meant by the deamination of one of the nucleic bases? What can result from such a deamination? Explain why deamination of ordinary cytosine produces uracil; but deamination of methylated cytosine produces thymine? Explain why repair enzymes are able to correct this former change, but can't fix the latter change? Why can't any of the other pyrimidines in DNA, besides cytosine, be methylated? What has tended to happen to CG sequences during evolution? Would you expect that this change has also occurred in insects, where DNA methylation doesn't occur? What is heterochromatin? What is meant by the heterochromatinization of one of the X chromosomes in female mammals? Why doesn't this occur in males? Would you expect it to occur in kinds of animals that use other methods of sex determination? Would it make any sense for the inactive X chromsome to be more heavily methylated than the active X? If you synthesized an analogue to cytosine that had a nitrogen in place of the carbon where the methylation takes place, what would you expect would happen if you fed this to some differentiated cells? About what percentage of membrane consists of protein? Besides proteins, what are the other major components of membranes? What special name is used to refer the membrane that forms the outer surface of a cell? Name as many different kinds of membrane found inside cells as you can. In what sense can a membrane be liquid in 2 dimensions, but not in 3 dimensions? About how far can different kinds of membrane molecules diffuse in one second? How does the structure of a biological membrane resemble one of Langmuir's monomolecular films? How do biological membranes differ from Langmuir's monomolecular films? Why are most membrane proteins so difficult to crystallize? What class of "forces" are responsible for holding together membrane components, and how is this related to the fluidity of membranes? What class of compounds serve to solubilize integral membrane proteins? What is the "freeze cleaving" technique? And what is it used for? Where does the cleavage plane usually run? Do you thing there is any relation between the location of this cleavage plane and the type of chemical bonding used to hold membrane components together with one another? What are some of the experimetal techniques that are used to demonstrate and to measure the viscosity of membranes? What changes on membrane components can make the membrane more viscous, or less viscous? Is it good or bad to have cholesterol in your membranes? Do the different kinds of membranes in your cells have the same or different lipid contents? What about protein contents? Where is glycerol in membranes? Is there any phosphate in membranes? Where? If you know the amino acid sequence of a certain protein, by what criteria could you estimate whether it is a transmembrane protein? ...whether it is a singlepass or a multipass protein? What is meant by a protein being prenylated or myristylated? Why wouldn't you expect prenylated or myristylated proteins to be singlepass of multipass proteins? Would you expected to have more difficulty doing X-ray diffraction on a prenylated protein or on a multipass protein? Where is spectrin found? What is it? What is a glycocalyx? Why do you think it is especially difficult/impractical to transmit signals from one side of a membrane to the other by means of the usual sorts of allosteric changes in conformation? Which molecular properties predispose to permeability through membranes? Which ions have much higher concentrations outside cells than inside? Which have higher concentrations inside? What is the resting potential? How large is it? What causes it? Which kinds of cells in your body have such a potential? Which cell types also have an action potential? Do you think that it would be possible to have an action potential without first having a resting potential? How long does an action potential last? What about the resting potential? In a cell with a resting potential, which of the following ratios most closely approximates the total numbers of negative charges relative to positive charges inside the cell? 1:1 , 2:1 , 1:2 , 100:101 , 1001:1000 ? What about the ratio of total numbers of positive relative to negative charges in a given volume just outside the cell? Why does the potassium ion concentration difference accross the plasma membrane not produce an appreciable osmotic pressure? In which direction would this osmotic pressure difference act, if it existed. Suppose that potassium ions had no charge (=weren't ions); then would their concentration difference produce more or less of an osmotic pressure differences across the plasma membrane? If you had some way of measuring the relative amounts of this osmotic pressure, versus the electrical pressure produced by the actual potassium ions; would the strengths of these forces be the same or different? What is an ionophore? Suppose that you had an ionophore that was spe