PRINT NAME (2pts):
TA:

PLEDGE: I neither gave nor received help on this exam. SIGNED:

Please read ALL questions CAREFULLY before starting. Answer in as short a manner as possible--writing down a lot of words won't necessarily help.

1. (15 pts.) You induce lysis in three independent E. coli strains which each carry an insertion of the same lysogenic phage and you use these lysates to infect a variety of E. coli mutant strains to observe complementation. Here are the results:

                E. coli mutant strain:          Complementation:

Lysate 1:               a-  b-  c-              mutations in a, b and c 
                                                  complemented

Lysate 2:               d-  e-  f-              mutations d and e complemented

Lysate 3:               g-  h-  k-              mutations h and k complemented

A) Is the phage performing specialized or generalized transduction?

B) Why?

C) Which set of three E. coli mutations are closely linked?

2. (11 pts.) Contrast the role of the repressor in an inducible system to the role of a repressor in a repressible system using one example of each.

3. (12 pts.) Which of follwoing occur during (or by) Mitosis, Meiosis, or Both?

No crossing over

Division in somatic cells

Chromosomes line up at an equatorial plane.

The end products are gametes.

Reductional division.

Homologous chromosome pairing.

4. (12 pts.) From the following DNA sequence:

5' CCCGTTCATTGACGGTTTAGGCGATTCATTTGG 3'
3' GGGCAAGTAACTGCCAAATCCGCTAAGTAAACC 5'

A) Which strand (top or bottom) is the coding strand?

B) Write the mRNA sequence for this strand?

C) Using the codon table listed below, translate the short peptide sequence.

5. (10 pts.) When the interupted mating technique was used with five different strains of Hfr bacteria, the following order of gene entry and recombination was observed. On the basis of these data, draw a map of the bacterial chromosome. Do the data support a circular chromosome?

Hfr strain:     Marker order:

        1       V I S L I

        2       S E L V I

        3       I V E S E

        4       S I V L E

        5       E S E L V

6. (12 pts.) Describe the molecular mutation which renders some individuals resistant to HIV infection of their macrophages and why. Assuming that this mutation has no adverse effects on the health of these individuals, why is it found in such a low percentage of people?

7. (12 pts.) You are hiking in the mountains and find two stands of true breeding plants of the same species. You harvest seed from one which is TALL and has YELLOW flowers, and one which is DWARF and has BLUE flowers. You cross them and the F1 progeny are DWARF and have YELLOW flowers. progeny (use H and h for dominant and recessive height alleles; F and f for flower color).

A) What are the genotypes for each phenotype of the two plants you found and the genotype and phenotype of the F1?

B) You want to take an F1 plant and test cross it to check for linkage. What are the genotype and phenotype of the test-cross parent you should use, and is it one of the ones you collected?

C) The progeny from your test-cross segregate as follows:

505 TALL and YELLOW     489 DWARF and YELLOW
515 DWARF and BLUE       501 TALL and BLUE

Are the two loci for plant height and flower color linked or unlinked?

8. (12 pts.) In Drosophila, a heterozygous female for the recessive X-linked traits, x, y, and z, was crossed to a male that was phenotypically recessive for all traits. the offspring occurred with the following numbers:

        x y z           4792

        + + +           4680

        + y z            220

        x + z             34

        x + +            232

        + y +             42

A) What is the genotypic arrangement of these loci on the X chromosome? Draw both chromosomes.

B) Construct a map of these loci on the X chromosomes, including relative map distances.

9. (10 pts.) Below is a drawing of a cloning vector. You want to clone BamH1 digested Kumquat DNA into this plasmid. You cut the plasmid with BamH1, ligate the Kumquat DNA and the plasmid and transformt he ligation mix into E. coli.

A) Why are the plasmid and the kumquat DNA cut with BamH1?

B) Why don't you use HindIII instead of BamH1?

C) Which antibiotic should be incorporated into the media to select transformed bacteria carrying a plasmid?

D) Which antibiotic should be incorporated into the media for replica plating to identify those E. coli which received a plasmid carrying a Kumquat DNA insert?

E) In the replica plating experiment, what growth pattern will identify the colony containing a plasmid with a kumquat DNA insert?

10. (10 pts.) The following two couples each have a baby daughter, as shown in the pedigrees. One couple decides that their daughter has no resemblance to either of them, is ill mannered, does not sleep through the night and does not like any of the foods they like. They fear that their baby was inadvertantly switched at the Hospital. In this era of litigation, they easily find a lawyer willing to prosecute this case. The following is a DNA RFLP analysis of both sets of parents and both babies. Do these people have a complaint against the Hospital and why?.

11. (15 pts.) In a theoretical operon, A, B, C and D represent the repressor gene, the promoter sequence, the operator, and a structual gene, but not necessarily in that order. This operon is concerned with the metabolism of a sugar called TM. From the data below:

Genotype                           TM Present              TM Absent
--------------------------------------------------------------------------------
A+ B+  C+  D+                      Active enzyme   	No enzyme

A-  B+  C+ D+                      Active enzyme   	Active enzyme

A+  B- C+ D+                       No enzyme            No enzyme

A+ B+  C- D+                       Inactive enzyme 	No enzyme

A+ B+ C+ D-                 	   Active enzyme   	Active enzyme

A-  B+ C+ D+ / F' A+          	   Active enzyme   	No enzyme

A+ B- C+ D+ / F' B+            	   No enzyme   	        No enzyme

A+ B+ C- D+ / F' C+            	   Active and inactive  No enzyme

A+ B+ C+ D- /F' D+  		   Active enzyme   	Active enzyme

A) Is the operon is inducible or repressible?

B) Assign A, B, C and D to the four elements of the operon described above.

12. (8 pts.) Two mice heterozygous for two linked genes (Ab / aB) 10 map units apart were crossed. Assuming that crossing over occurs during formation of both sets of gametes, determine the genotypes and relative frequencies of the resulting gametes.

13. (14 pts.) You have cloned the immunoglobulin heavy and light chain loci from a new mammal with a limited set of Light Chains in its antibody proteins. You note that there are the following number of mini-exons:

        VH      200             DH      6               JH      3
        VL      1                                       JL      100

A) What is the potential combinatorial diversity of this animal's antibodies?

B) What is odd about this set of mini-genes that might account for the finding that this animal has only a limited set of Light Chains in its antibodies compared to other mammals?

14. (12 pts.) The tryptophan (trp) operon is controlled at various levels.

A) When free tryptophan levels are high in a bacterium, how is transcription of the trp operon regulated?

B) When free tryptophan is low, but charged tRNA-trp is still present, how is transcription regulated?

This is a diagram of some of the key components of the trp attenuator region:

C) Using this diagram as a base, draw the situation reflected in part (B).

D) Again using the basic diagram, draw the situation when charged tRNA-trp levels are very low, or absent.

E) What is the end outcome of the situation you drew in (D)?

F) What is the outcome of a mutation in Region 2 of the basic diagram which prevents it from participating in a stem-loop (hairpin) structure and what is the phenotype of the mutant?

16. (13 pts.) From two Neuropsora cross + + X a b and + + X c d, the following frequencies of ordered tetrads were obtained:

        1st cross Spore pairs:

        1-2             3.4             5-6             7-8

        + , +           +, +            a, b            a, b            241

        +, b            +, b            a, +            a, +            256


        2nd cross Spore pairs:

        1-2             3-4             5-6             7-8

        +, +            +, +            c, d            c, d            8520

        +, +            c, d            +, +            c, d            1348

        +, +            +, d            c, +            c, d             132

A) Which cross features linked loci and why?

B) From the cross featuring linked loci, calculate the map distances from each locus to the centromere and the gene to gene distance.

17. (10 pts.) From the following restriction digests construct a map:

18. (10 pts.) You have isolated a transcription factor from leukemia cells and you notice that, in samples of this leukemia from many different patients, this transcription factor is always phosphorylated. You isolate the same transcription factor from normal white blood cells and notice that it is only phosphorylated after stimulation with a growth factor. Your lab partner finds that the leukemia cells grown in culture express phosphorylated transcription factor in the absence of growth factor, and in fact that they lack the receptor for this growth factor. Since the leukemia cells lack the growth factor receptor, list TWO of the potential mutations which would allow them to express constitutively phosphorylated transcription factor?