(5) 1. What is the key difference between lytic and lysogenic phage growth?

(10) 2. You have induced in an E. coli strain carrying a lysogenic bacteriophage. You use this lysate to infect several other E. coli strains, with the following results:

  E. coli strain         complementation by phage

  

  

  met-  gal-        		Yes

  met-  his-        		No

  met-  thi-        		Yes

  

List all of the genes that are closely linked.

Is this a "general" or "specialized" transduction?

(12) 3. In complemenation studies of the rII locus of T4, three groups of three different mutations were tested. For each group, only two combinations were tested. On the basis of each set of data, predict the results of the third experiment?

  Group A           		Group B        			Group C

  d x e - lysis			g x h - no lysis   		j x k - lysis

  d x f  - no lysis 		g x i - no lysis    		j x l - lysis

  e xf -  ________?     	h x i  -________?    		k x l - ________?

  

(12) 4. Predict the theoretical results of conservative and dispersive models of DNA synthesis using the conditions of the Meselson-Stahl density gradient experiment. Follow the results through two generations of replication after cells have been shifted to an 14N- containing medium.

Include a diagram of the position of the replicated molecules in the centrifuge tube before and after switching to the light medium.

(12) 5. Here is a double stranded DNA molecule. Write the mRNA and the resulting peptide sequence derived from the DNA, using the universal code below:

5' CCCAGATGTTCCCAAGAGAAAAAACGGTACGTAGTTATTGA 3'
3' GGGTCTACAAGGGTTCTCTTTTTTGCCATGCATCAATAACT 5'

(8) 6. Write a brief description of the function of each enzyme (use the space provided).

I. DNA gyrase ______________________________________

II. DNA ligase ________________________________________

III. DNA polymerase I ______________________________________

IV. DNA polymerase II ______________________________________

V. DNA polymerase III ______________________________________

VI. Primase ______________________________________

VII. Helicase ______________________________________

VIII. Telomerase ______________________________________

(10) 7. Several temperature sensitive mutant strains of E. coli are isolated that display various characteristics. Predict what enzyme or function is being affected by each mutation:

a: Newly synthesized DNA contains many mismatched base pairs

b: Okazaki fragments accumulate, and DNA synthesis is never completed

c: No initiation occurs

d: Synthesis is very slow

e: Supercoiled strands are found to remain and replication is never completed.

(15) 8. What are the five steps in recombination? What are the possible ways the recombination junction can be resolved. Use a drawing with flanking markers to distinguish the products.

(10) 9. Each transfer RNA requires at least four specific recognition sites that must be inherent in its tertiary structure .

a) What are they?

b) Illustrate the steps required to charge the tRNA.

(6) 10. What are the three different species of RNA? What are their roles?

What are the three different species of RNA polymerase? What are their roles?